Description :
From Genome Similarity Track
Location :
Scaffold_216:16412- 17830
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_216-snap-gene-0.15Serine protease family S10

Sequence
1418 bases(100 bases per row)
AGCACAAAGAGATCCAACATGCGCTTGGCCTCCACAGGTTTCCACATCGGCACCAAGTGGCCCGCACCCTTCACCGTCAAGTATGTCAATCCCTTAAACT
CCTCGACAAAGCCACCAGTCTGCTGAGTACCGTCCAGCTCCACCGACCAGGGCTTGCGCTTGCCCAGACGCTGCAGCTTGAGCGATTCGACGGCCCAGAG
GCCACCGATGAAGTCGCAGACCATGTCGGCATCGCCGTGATAGATCACGCCGCTGATGTTATGCGCGAGCAAGTCCTTCCAGATGGGCGTCACCTCCCAG
TTCAGCGTGGAAGTGTAGCCGAACAAGCGGCTCTTGTCGATCGTGATATCCGAGAGACCTGGAATCAGATCTTTCATGTCCAAAATCTGCGACGAAAGCG
CCGCATTGTTCCAGCGGTCGATGTCGTCCTTCGTGTGCATGGCATCGCGCACTTTTGGCGTGTTAAAGTACGTCTCCAGGTTGGTTGAGTCCAAGCATCC
AACCGACGGCAAGCCGAGTGGGTGTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCGTCGGCTTTTCCAGCAGCCGCTTTGTCAGCTCCTTAATG
CTTTCTTCTGGTGTACCAGCACAGCTACCGTGGACGTTATACGTGTTGATTTGTTCAAACATGATCTTGGTCGTCGCTGTCAACGTCGCTTGGCCGCATG
GGGAGTCCATGTCCAATGCAGACTTGTTCGTCAGGGTCGGCTTGAATTCCTGAAGCTCTGGACAGCTCGTGCGGATGTTCTGGTACTCCTCCGTGCTCAA
GATGCCGTGATAGTACGCAAACAAGTGCTGAGAAAGACCAGAGAACTCGTTCACGCCATTGCCGACCACAAACTTCTTCAAGTTGATCTTTGGTTCGCCC
TTCAAGTTGCCTTCCACAATGTTGCGCGCCGTCGTTGGCACGTAAATCCCGCCGTAACTCTCACCCGAGATGATGAAGTCATTCGCGCGCAAATGAGGAA
ACTTGACAAAGAACTGCTGTAAACCCTCGTACAGATCCGCAGCCTGGGACAGATCGTCCGACACGTACACGCCACTCGCATTGTAACTGAAACCCACGCC
GATGGGCGACTCGATGCAGACGAAGTTGGCGTTCTTGTTCCAGCCGTACTCGTTCGCGATCAGACTCTTGCCGTCTGCACTCACGAGCAAGGGACCGTTC
TCGGAGAAGCAGCCTGCAAGCGAACTCGCGCCAGGACCTCCGTTCAGCCACAACAGCACGGGGTCTTTCGCCGGCTCCTCACTCTGTGACTCGGCGAAGA
AGTAGAACGCCTCACCGCCATTGTGCAGCGGCAGGTACCCCGAGTACAGTCGCGNNNNNNNNNNNNNNTCGTCTGGCTTGCCAAAGAGGTTCTTGATCTC
GTCCGCGGCGCCAGGGAA