Description :
From Genome Similarity Track
Location :
Scaffold_900:16411- 17721
Transcript NameFunction/comments
Phypl_g11538hypothetical protein

Sequence
1310 bases(100 bases per row)
NATGAACCTGTCGAAAATACTCGCTCCTGAAATGCCGTTGAACAGCCTCGCCCCAACCAGACGCGTGCAAGCTTCGCGATCGACAGAAACTTTGTTTGGC
CAACCTCCGCAAACCAACGGCACACGTCGATATGCTGACAAAGCTGCTCAACGTTCCATACACGTACGTTGCGTTTGCTGCGCATGCTCAGCTTGGCAAG
TATCTTTTCGGCTCGTTCTCGTTCCGCGACTGGTGCTTTGCGACTTCATTCCACTCCGCTCTATACGCCAGCCACTCATCCAGCACTGCATCTGCTTTTG
CGTGTAGAGTATCTTCAGCAGGATTATTCTCGACAGGTAGCGAGATCTCTTCCCCGCACAATAAATCTAGCTCGTTGTCCGAGGTATTACTGCATTCTCC
GCGCGGTGAGCTTGActcagaagctgctgcgccgtctTCGTGCTCGGTGTTTGCGAAAATAGCCTTATAGATCTCGCGATGTTCAATCCGCAGCAGATCC
TTTGTTCGTTCTATAATTTTATCGGtggctgcttctgctgcatcagGGACACGCAAAAAGTTCTTCGCAGTTGTCTTCGTACGTGGATCCAGAAATAATG
ACATCCCCATGGGTACACCTGGCTTTGGGAGACGCTCTGCAATCTGGTGCAGAGTACGCGTGATGCAGCGCTCAGCCAATGTAGACAGAtccggcagctt
cagctcgatGCGCTCAAATTTTCTCTCGTTAGTGTCCCCGTTACGAGGCCCCGTCTGAGTATACGATGAAAATTTGTACGTATTCATGCGTGCAGAGGCC
ACTCGTAACAGCACATTCATCGTTGAAGGTATCATAGTCGCCGATTGAGTCTCAGCTAGCGCTAATTCTGCTACGCACTGCATGATTGTCTCCATCTGCA
CGACTAACGCCCGCTCACCATCGGTGATACAGTCGAATACTTCTTTTCCGTTCTTCGTAACATCTGCATTTTGAAAGAACGCCTTAAATGCCGGATAGTT
GATAATAGATCGCTGAAACAACTTAACTGTAGACACCACTCGAACATCNACCTGCTCGAAGCGAAGAAGTTGTTCAGAGCTCGCAATTTTCGGATAACCA
CACCACCTTCCGGGAACGCTCCATCTTTGGTGACAACAATCATCTTCTTGATGTATGATTGTGTCTTTGGGTCCTTGACGAAATCATTTTTTACGTTTTC
CTTCAATCCAATGCCGTACCCGATGCAAAGGTTTAACGCGTGCATCGTACAGTCCGTTTGCAAAGTTGTGTCGAACTGCCTCGATACTTTccgcgcggcc
gccgctgtGT