Description :
From Genome Similarity Track
Location :
Scaffold_2:164101- 166421
Sequence
2320 bases(100 bases per row)
GGTCTTGAGTTTCCGACGTCGAGAGCGGGGGGGGGGATGCATGTTTGCGCGCGTGGGTCTGTACGTCCTTAACCACATGCCAGAGGCACAGCAGCACCGG
GACGTCCGGAAAGACCTGCTCTAACGCGTTGAGCAGTGCCAGGTCTCGGTCGACGAACACGACGGCAGGGGTTTCAACGCCATTCTCGCACACATCGTCC
TTAGCTGCCTCAGAGCCCAGCAGTAATCGTTCTTCTTCTCGCCTCGCATGAACGCTTGAGCCACATGCAGGGTCGTGTTCATCCCGCTGATTCCCACAAT
ATTAAGCAGCGGCATGTTGAATCGGTTCGTCCTGTAGGTACAGTCCATCAGAAGGACATCTGCGTTTTCCTTCCAAATTGCCATGACTTCCTTGTGAGCA
AAGAGCAGGTGCGTCAGTCTTCTAGAGGTGTCGACCTGTTGCGCCACGTAGAAATGGCCGCGGCTCAGCAACATCAGTAGGTGCTCGACACGAATGCTAC
TACCGAGAGCGGCCGTTACGGCCCTGGATCGCTCGTTGTAGATGTCACGGGCGATAATAGGCGCTTCTGGAGTCTCTTGATAGATTCGCGCGAGGGTCTG
AGCTGCTCGGGTGCCAGTATCACTGTCGGTAGCAATAGCCACACGCAACACCGACGTCATCGCATTGCGACGATGGACAGGATGCGACGCCGCGTGGTTG
GATGGAGGGTGGTTGTGCACGAGTCGCCACTTACGCGCACCACACAGACTTTCATTTGGCAGTTGCAATTCCGCGACGCTGCATTGCGCCTGCGCACGGC
GGGTGGCGGAATATAGTGCGTTCGTTTCACTCCATGACGGTCGCACCCGAACACCACACGACGGACGTCACCGTACTTATCGCGATAAGTACTAGTGGTA
ACTAGTCCGTAACCGTGATGTTGCGCATACTCGTTCAACGCTCGTTTAGTGGACGCCGGAGAGTCGAAGCTATGCGCGTGCAGGCAGGGCATCTCCCACC
GTACTTGGCGAGCGCCGAGAGCGGTGCAACCTTCATCGCCTCGAATAGCCTGGATACAGCGAGGGTTGTCTGGGTCGTTCGGGCTGGCGTAGGCAGGGGC
GATCGCAGGGGTGCAGAGGTAGGTTGGAGGCGAGGCTCTGGCGGACATCCGACAGAAGGTGGGGTGTCGGCCGACGTCCACACCATTTCGAACGGCGCGA
GTTGAGATCTTATTTCGCGCAATGCCAAGCACACGGAAGGGTTCTCGTACCGAGAACTTGAACCGGGGGGCGCCTGCTGTTGCGGCGCGGGACCGCCTTC
GATACGACACGATGCTTGAAAGGTGCGTAGTGCCTCTGGGATGGAGGATGCCCACGCAAGCTCGAACGCGTCCGTGGAGGGAAGCGGCGTCATGGCAGGT
AGTAGGAATGGGGCGGGGGGGGGACAGCTCGGGGGGTTAACCGACGCGAAAAAGCGTGATTGAATGGCTGAGTTGTAACGGGGTTACACGCACACGTGGC
TACAGTCACTTGTTACTCTAACAGATGCGATGTCTGTTAGAGGTTTGAACACTTCCTCGACCTTGGTGTAAGGTACACCAATGGCTACATACATTTACGA
CCACCACGACGGGTGGTCCATGCACATTTAGGATTCCTATTGGCTGAAAGCAGCATCTTTTAGCCAATGAGTGACTTGCATGTTAGCAGAATCCTGCCAA
CCAGCCGTTGGCAGATTCCTAGCTTAGAATATAACATTTAGAGGAAGTTAGAAACATATACAAAAATAGCAGTTCTCATATTTTACCAAAACCCGCTACT
TGGAGTCTTTATCTTGTTTAAAGTATACTCGTGGATCTCGAGTATACTTAACTCAAGTAAAAGAAACCTAAGCTTCCTCATACACGTGCGCATACGTGTA
AGCCGTAGTAGTGAGCCAAGGTAGGACCACTACATGAGTGCTCGGAATCCGAGTCATGTACAAGCCTATACCAAATTCAAATAGAGATTCGTGGATATTT
ATTGGTCATTATTGTCCAAATTAACCCGCGCGATTGGATAAAACCATACAAAGAATCGGGTGCAGGGATTCGTTAAAAATATGTAAACAAAGATTTGAGC
TTGCGCGGATCGAAGTACTGCTGCTGTTGTTGTTGTTGTTGTGTTACGTCTTCGCGTCAATCTGTCTTACTGGGAGTCTAGATGTAAACTAGCTAGTGTC
CGGCGTAGGGTAGTGTCCGCATACGTCAAGTCGTCCTCACAGGACATCCACGCGATGATGTCTCCCACGAGTTTCTTCCGCTCGGTTGTGTTTTATGCTT
GGGTACGAAGCGTGAGAAGG