Description :
From Genome Similarity Track
Location :
contig_194:1641- 3663
Sequence
2022 bases(100 bases per row)
AAATGCTCGCCGTGGTTTCGTTGGGATAATAGGCTCAGTAGATTGCATGCACTGGCAATAGGGAAATTGTCCGACTGCACTGGCCGGACAACACAAAGGG
AAGGAGAAAAAGCCCACTAAGATTCTTGAGACCGTCGCAGACTACAACTTACGAATTTGGCACTGCTACTTCGGGTCTCCAGGTTCTCTAAACGATATCA
ACGTTCTGGACCAGTCTCCTTTGTTTCAAGATTTTCTGCAGGGTACTGCTCCCCGTGTCGAGTTCGTGATATCTGGTACGATGTGCTTCATCACATTGGC
TTTCTTAATGACTGCAAACTAAATTTGAAACTCGTAGGAAAGCCGTATGACACGCCGTACTTGTTGGCAGACGGAATCTACCCTGAATGGCCTGTGTTTG
TCAAACCTATTGAGAAATCCCATGGATTAAAACAAAAGCACTTCGTCAAGCGACAGGAAGCTTGCCGCAAGGACGTGGAACGATGCTTCGGTGTGTTACA
AGGGCGATGGCGCATAATTGACACACCCTGTCGTCTTTGGCGGGTAGATGCAATGGCCCAAGTGATGCACGCTTGTATAATCCTCCACAACATGATCATA
GAAGAAGAGCTCAGTGAGCTCTATTGCAATGAGCATGAGCATCTTTACGATGCCGAGGCGCAGTCTGGTGGCATTCCAGTATTCAATACTGTTAGGCCAC
AACGACCACTGCGATCTTCTACAGTTGCTACGCTGATATCTAACTCGCACAAACTTCACAACACTAACCAGCACGCTCGGTTGAGATCGGATCTCACAGG
TCATCTCTGGACAATGCGCGGTCTCGAAAACTAGTTAAAATTTGCAATATACGACCCTTGGGGTTTGAACTTAAGCAGTGCTAGATAATTAGCGATAATA
CAACATCGGGTGTTGTCGTTGCAGTAACTGTGGGGGATGGTTGGGCTGCTGGAGTTAATGGCGCGGTAGTGATGGACTCTGCTCTGGCTGGATCCGGCTG
ATCACCAAGCCGAGATCTATGTCCTGCAGCTGCAGGAGTATCTGTGTCAACAGCAGCAACCTCTTTACGAAGTCATGCTAACACAAGTCGTCGTTTGAGC
GCGATGAACTCCATCGTCACCGGGTCGCTAGTGTTTGTTGCCATGCTAAAAAAGATTGTGCTAAAAAAGATTCTGATCAACTTGATTTTAAACCACACGA
ACGCGAGCATCGGCTGTTTTCGCCATTCTTTCGGTGGCTTGCACTTGTCTAGAGTAGAGAGCTAGGTTTGCGCGCTCCATTTTAGCACGCTGCTGCTCGA
TGAGGCGCTTATCTTCTACTTCTGTTTCTGCTGTTGATGTACCATCGGATATGCTACTCCCGATACCGTCCACAGATTGTAGTTCAGCCAAACATTCGAC
TGCCGTTCGCTTCCTGAGAGAGATCATCTTGGCGTTTCCGTCTCGCCAAACGCCCCACTTTGGCGAGTCTTTCAAGATGCTCCAGCACTGCAAGAACCGG
AATTTTCCGCTCTCAGCTTCGTACAGCTCCACAGCTTGATGAATGACGTCCGTTGGAGATCTATCACTAACATCCAGCCGGTTCACCTGCTTGAAGCAAC
CGACAAACTTCGACACAGACCGCGAAATTGTCTGGAAGCGCGACTTCAGCGAGCCAGGATTTCTCGTAGTAGGAGTCCCTAGAATTCCATCAAACACCTT
TCTCACCTTGTGATACATGTCGTCTCCGGTCTGATTGATCCCAGTTGCAGGATCACAGTTAGCATTCAGCCATGCCTCACACAAAGTCTTATCATCTGCA
GCACTGTAGTTCGCTCCTCGTTTCTCGGACATTTTGCAGATTGTTCACCACTCCGCTGGTGATATTTTCAGAGACAAATATAGCTCTAGATGTGGCCCCG
ATGGCCTCAAAGATAAATCTGTTTAGCTTTTAGCCGCCCCGGTGGCGCTGCGCAATGCTATCCTAGTGCCAAATCTGGCATTTTGGGGGGCTAATAGCAC
TCCGGTGTGGTCACTCTAAGGC