Description :
From Genome Similarity Track
Location :
contig_14:164088- 165215
Transcript NameFunction/comments
g2932.t1hypothetical protein

Sequence
1127 bases(100 bases per row)
ACCGTCTTGAAGAACGTCTCTATCGGGAACTCTCGGTAGCCTCGTCGCAACAGAGCAAGGAAAAAAGCGTCAAATCCAACGACATCATCGCTGCGTGAGA
AGATAACGAATGCTGATGGAAGAGCTACTGATGCCGGATCCCCAGAGCTCAGTCTCGAGGATGGAGAATACTTTAACTGACATTGCCACAGGTGACGCAG
CTTCTTCACAGCAGGTAAACAACTTTGTTGATAGTCAATTTGATCGTAGCAGCGAGACGAAGGCGCCGAGTCTTGCTATGCTGGATCTTTACATCGACCG
TGTTGTGCTCGACGATCACCCAACTTTCGAACTAGCAGACCGTCTCGCCGCACAATTGCGGGCCTTGTACACTGCGTACATTCGAATGCAGCAGCTTCAG
CCATGGCAGCTTTCACTCCAGCGTCTTGACGAATTCTTCTCCAGTACTACCGACAAATTGGCGGAGGCAGCTGGACGCAATCGTGCTATGGCAAGAACTG
ATCTGCTACCACACCAAGTAATCCAGGAAGCGAACCAGCTACTGACAGATTTGGAGGCCCTGAGCCAACTCCACCTGCAAATTGTAGGCAAAGCGAATGA
GCTGCGTGATGCCGGCACTCGTGCTGGATCTGCGCTTCAGCATCGAGTCAAGTCACGCCATCGCATGCAGCCTATTGATTTATCTCGCGTGGAGGCAATC
TTGGAACTTCTGGAAGCGGGAACGGATAATCAGCAAAAACAAGGAGTGGAGAAGAACGACAAGCTGCAGACGACATCTCGGAAAATCTCTGAGCGTTTAT
CGACGCTTTCTTCTGCCTCGACTCACGCGTTGCAGACTGTGTTGATAGTGGAGAGCGTCGGTGGCGACAGTCAACTCAATGAGGTGTCATTTTGGAGCCC
TAGATTTTACGTGGTGCTCCGGGTGAACGGGAAAATTGCGTGTTCGACGAAAATTCAACCTTGGTCTCGTGGTGAGGTTCGCTTTGCCGAAAGACTGTGC
CTCACACTACCATTTTTCCCCTCCTCGGTCTGTGCGGAAGTTTATGAACGACGACGGCTACTACGCGATGAGCTCTTATCCACGAATGCTGTTCCTGTGG
TTGTACCCGGGCAAAACGTTGCTCAGT