Description :
From Genome Similarity Track
Location :
Scaffold_1171:1640- 2839
Sequence
1199 bases(100 bases per row)
AGCGCTTCAGTGGCTAACGAATCCGCGGCAGCGTTGTATTCTCGTACAACGTGAAGATATTTAACTGATCGAAGCTTGGCCGTGAGTTCCTTGTGAGTAT
TCAGCAGCGCTAGCAAAGTTTCCTTCCTGCATGCGATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCACCAACGATGACTAAATCCTCGGCACC
GTGCGCAATAGCAGCCTTGACACCGTTTATCATACCTGTATACTCTGCTTCATTCACCGTGGTAGCCGAGAGGTAAGCGTTTGCAGCAATCACTACCTTC
CACTCAGGAAGGCTCCACAGCACCCATGAACAACTCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGACATGACGAATCCGCTGTAAT
TACGGGAAAGCCTGGCGTACAGCAACGCGGGGTCCATTCGAATAGTCGGGGAACCCTTGTTTGGAGGCGCCACCGGCGCGAGCGAGTCTTCCAGGTCAAC
GAAGCTCGTGATGCTTGACTGCAGTAGCTGCGCAAAGGCGACATCTTTCTCCTTCACGCGCTGCACCTTAAGGTGCCACTGCGAGCTGGACCGCGCGTCC
GAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACAAGGTAGCGTCTTTCCTGCCAGCTGGACATAACAGATCTTCAACAG
CAGAAGTAACGCCAAAACTTCCTTCTCAGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACCCGACCGAGGAACCGTACGGGGTGTAACTTGCCTTCA
TGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGTG
AAACACTCGTCTTCAATCTTTCGAAGGAATGACGTGCCACAGAAAGGCCACCTTCAACGACAAAGTCTTCATCCTTGAGCTGGTACAGCGCCGCACCATA
GACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTACTCGTTGGAAACGAAAGCTCGGTGATAGCC
GCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGATAGAAAGTCCACCTTGGGTTGGCAGAAGATGCTCTTGGTGAAGCTAATG