Description :
From Genome Similarity Track
Location :
Scaffold_955:164- 7131
Sequence
6967 bases(100 bases per row)
TGACTCGCCAGTGGACCAGACGGCCACAGTTTCTTCCGACACTTCCTGGGGCACCCTGCAGCGACACTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAA
CAGGGTATGAGAGCGCCCGTGCCACAAGCGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAGTCAGTGGAGGGAGACAACTCCCATGATG
AGTTCGACCCAGATGATCTGGATGGCCCATCCCCATCGTCAGCGGTGGTAGCAACAGCCGCAGCCGGGGCGGGTGGATCGTCCATGATCCAGAGGGTACG
GATCTCAGCCATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGACGAGGATCGAGCGAGAACATGGATCAGCAAGGTCAAGTCGGCCCTCATGAGA
GATCAAGCGTCGGATGCCGAGAAGTGTCTGACCTTTGCGGATCTGCTAGCGAGGCCAGCCAGGAATTGGTATCGGCAGCTGGGTAGATCCACCAGGAACA
AGTGGTCGGATTTGCTGCGCAGTTTCCAAACACAGTACTGTGGATTGAGGGTGTCGGTGGCACGATAGTACTACCACGCTCGCCGCAGATCGGACGAATC
CCCGCTGGAATATCTGCATTGACCAAATGTGGCCGGGCTACGGGCCAAGTTGAAGGCCAAGGATGGGGGATCTAAGGTACTGCGGGAACACGTGGATCAT
TTCATCGAGACGTTGGGAGATGTGGATCTGGCGGACAGGCTGATCCTGTTACGCCTTCCAGACGCAGATGAGCTTGAAGAAGTACTGCAGGTTGTGGATC
GCGCGAAACACCTCCAGAAGAAGGCGGCAGTCAGAATCGGAAAGTATCGCCAAAAAGCTCCGACACCTACGGCCCCAGTTCGACGCGTCCACCAAGGCGC
GGCGCCCGACTCAGGAACTGAATCAGATTCCGATGGTTTGACTCCGACCCATAGGATTACCGCCGAGTCTGTCTCACTGCGTCCAACGATCGTACGGCGA
AGACTGAAGACAACTCTCGCACTGGGGATGCCGTACCCGGGGACCGTGGGATGTACAGACCCGAGATCTCATGGACGGGACAGGATAAATCAGGTGCTCG
CAGTGTGGATCCCGGAAGCACACAAAAGATGGATGCTGGAAACATCTGGTTTGTGAGAAGTGTGGCAAGAAGGATCATCCCGGAGATCATTGCTTCTACG
TGTGCCGCGGTTGTGGCGAGGTTCACGACATCGGCAAGTTCCCGATGGAGGAGTTCTACAACAAGATCCGCCAATAGTTTGATCCAGCCAAGCACAGAGG
GATGATGCTAGAAGTGGCAGAGAAGCTGTTAAACTAGGTCGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGATATTGCATTTATGCATTTG
TGAACAAGACATCGCTAGATTCAGGTAGCAGGTCTCTATATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGGTCTCTAGTTTGCG
CCAAGTGGATGAATTCGCCAGATCCGAAGTTTCTTCAACCCTGGATCTACAAAGGGGAAAAGCGCGCGGCTACTGGGAGAAACGACAACATGGTCGATGG
TTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCCCCGGTTTGTCCGGTCACTGGACCCGTGGATCTGAAGATGTTGGATCCATGGATCTGCTGAC
AGGGGAGTCCCGTGGATACTAGAAGTACCATGTCCCAGGAAAATGGTTCAGACAAGCCAAGGTAGGGGTCAAGATCAACAATGAAAAAGCAATCCTACTC
CTAGATAGTGGTGCCGAGGTGTCTATATTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAGGATTGTGTTGGGATTG
GTGAAGGCGTGTACCGACGAATGGGAGAACGCGGATCCAGATCATGATGGCAGGCGGTTTGGTATACTGGTTCGACATTTGGGTTGGAGATCTCACTGGT
CAAGATGCCATCCTCGGGATGTATTTCATGGTACCAGCCGGCGTAAGGTTGGATCTGGCGGATGGGACACTGTGTTTCCCGGACGAAATGCGGATCCAGC
TCAGCGGACGGCGACCGTTGTACGGGGCGAAGATGAGGATCGTAAGGGCGGATAAGACGACCTGGATCGAGCTCGGAGAAACCTGGGAGCTGCCAGGTCG
GTTGAAGTGGGTGGAACATGAGAAATGTGGGTCACCCGGGGTGAGAAGTGGGTGCCTACAGTATTCCAAGGACCAGGTCGATCACAATACCTCCAGGTCA
CAAATGGCAGCGACAAGAGACTATTACTGGACCATTATGAGGAGATTGGGCGATGGTTGGCGAAGGATGGTGGGTATCCCTAGGCGACCTGGATATGTGT
CAGTTGGATCCCGTCGCTACAGAGAATGGCAGAATCTGGCGTATGAGGCGACTACCGAGATCGAATCCTTTGCGGAAGTGGAGCTCCCGGCGGAACCAAC
TGGCCCCTTGGTGGCCTTCATACCAAACTTCGCGAAAGTTCCTACAGAGGGATCGTCGGATTGGGATTCAAGTGGTAGAGATTGGACCCAAGCCCGCTGG
TGATACCCAGAGCCGGTCCCTCGATAGCCCAGGTTCGGTGGATGTGGGATCGCAGATAATTGAAGCCGGCTCGCTGGATCCTGCTGACCCACAGTTGGAT
TCGAGCTTTTCATAGGACAGCGTGCCCGGATCCTTGTCGAGAGTGGCAGCACTGGCTAAACAGGAACCGTCGTGTGTAAACTCACCAGAGGATCAAGTCG
ATTCAAAAGATAGTTTCCCCGGTACCAGGATACCCGATCCCATACAGACAGAAGAAATGACGGGAGAAGGGGTGTCGCGGTGCTTGGGTCCAGTGGTGGA
TCGGACAAAGACTGAAGAAGAACAAGTCTGCTACCATGAAGGCGGGGATCTACACGCCGAGGGCTTGGAGAAGGTATGGCGGTGATCCCGGAGGTACCAC
TGACCACAGAGGAGGTCACGATTGATGATATCCAAGTGGATCCGGGGGCGAACGAACCCGCGGAAGTGGATCGACTACGTCAGAAGATTTGGGAAAGCCG
AAATCTGTTAATTGGCAAAGCGAATGCATTACCACCAGCTGCACGCGGAGTCAAAGGTGATATTGATGTCGGTGACGCGAAGCCGATCGCTCAAAGGGTG
CGGAAGGTGGCGCCTCAGTTCCGAGAAAAGCTATTGAATCTGATTAAGGGTCTGCTACAAGCCAAATTAACAGTTTCTCAACGTCTTCGTGGGCGTCTCC
TGTGGTGATCATCGTTAAGAAGAACGGAGTGGATAATGCTTGTGTATTGATTCCCGGATGGTTAACAGCCTGACCCGACTGATGGTGTATCCGATGCCTT
TAATCAATGAGCTATTGGAAGACTTGGATAAAGTACTCTGGTACTGTTATCTAGATATGGCAAGTGGTTTTTGGGTGGTGACTATGACCGATCGAGCTCG
CGCAATATCCGCATTCATCACACCATTTGGACTGTTCGAATGGAGCCGGATACCGTTTGGATTGAAGAATGCACCCCAGATCTATCAACGCCTAATCGAT
AATGCCCTCTACGGATTTACCCGAATACCAGAACCCGTAAGAGGTGAATCCGGGGAAGGTCATACGGAAGTGGATCCATTCGAAGCAGGAGAGCCAGGTG
GATTGGGAACTCCATCCGTGTTAGGACGCAGATCCTATATCGACGACATTATAATCCCGGCGGAATCTTGGAATCAGTTGTGCGAGAGAGTGACATCCCT
ACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGCGTGGTGAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGTCATCGAGTCTCCAAGGAG
GGATTGGAGGCGAATCCTAAAGACCTGTCTTCGTTGGAAGACTTGTCCTCCCACAGTCGCTACGGGCGATGGAATCCTTCTTGGGTAGTTTGAACGACTA
CAGTCGGTTCATCGAGGATTACGCACTTTTTTGCTGCAGTACTCTATGAATTGAGGTACGTGCTTTTTTTGCTGCGATGGCCACTTCGGCTGTCCGGATC
AAGATCCAACAAGCTCTGGCCCTAGAGATCCCAGATCCACGAGGGGATCCACGTAGTACGACGCCGGAAGACGCCTAAAACAGGAGCTGGATCCATCCCG
GGACCAGCGGGGAGAGGATCCAATCTGGACAGAGCTGACGGAGGAAAGATCGGAAAAGGTGGAGCCTCGGTGGATCCGAGTTCAGCACGCGTTTGTGGAG
CTAAGGATAGGATCGCGACGACGCCCATCCTCCGCCATTTCGATCCGGAACGTCAGCCTACGGTGATAGTCTATGCTAGTGATTGGACGGTCTCAGCAGC
TTTGGTACAAGAACATGAGGGGATCTGCCATCCGATCACCTTCGTCAGCCGAGCGATAAAGCCGAATGAGTTGAATTATGGAGCGGTGGAGAAGGAGATA
TTTGCACTCCTGCGGGTGTTGGATCTCAATTATATCCTGCTGGTGGGAAGATGTATCCGGATCTTGACTCGCCACTCCACGCCCGCCTGGTTGTTCAAGT
CCGCCGGTCTACAAGGACGGTTGGGACAATGGGTAGCTTTACTTTCACCATGTACACTGGAGATCGTAAAATGTTCCAAAGGCGAAAACGAGATCCTGGG
AGTTTTGGCCGCGAGCATAACCCCCAGAGCCAAGATGGACGAAGCACTGACTAGGATCGCTCCTAAGAAAGAACTCAAACGCCGGATCCAGATCCCTATC
CCGACGGTACAAGCGGATGAAGATCTGTACATCCTGAATTTTGATGGATCTGCTCGCGTGCGGCGCGGAGGAGGAGCATACAGCGCAATTATGTGGAAAT
TGCCCGGATGGGAAGTGGTAAGGGCCAGATCCACTTACGCGGAAGGCCTCACCGTCAATGAAGCGGAGTATAAAGGACTCCTGCTAGGGTTGGATCTACT
AAAGGAAGAGGATCCAGAAAGGCTGGTGATGTGTGGAGATTCGAATTTGGTGATCAGACAAGTGCGAGGTCAAATTGATTGCGAGGCCCCGGCCCTGACG
CGGTTAGGGCAGAAGGTAATGGTTCACTTACGTGGTTGGATGAATCACGAGCTGGTACATGTCAAGCCAGATTGGAATGCCAGTCCAGACAGCTTAGCAA
GTGCCGCTTTACGAAATCAATGTGGTGTTGAGGTGGAGAGAGGGGCCGAGCGTCAGGATCTCATCAGACTAAACCGACTAGACAAAGTGGTGGTGGTTGG
ATCCGTGAAGAGAACGGTCCAGGTAACGGCTGTCACTAGATCCATAGGAAGGATTGGATCCAGTCCCCAGATTCTAGATGAAGCATTTGTGAAGGGAGTC
CGTATTGAGCGGATTCTCAAAGCACAGAACGAAGAAGTGTGAATTCTGGGGCTAAAGAAGTATCTGATGGGGGATGTGCGAGACCTGAGTCGGGAGGACG
CCAAATCCTACAGTATTATCACTATGGATTATGCAGTGGATCTGAATGATTTGCTCTTCTATTGTCCCCCTACGAAACGAGTCAGCGGGGACCGAGACGG
ACTGATGAGATTAGTGATGCCGGAAACTTGCAACAGGATGTCTTACATCACTATCACGCTAGCTTTGAAGGTAGCCATCAGGGAATCGGTCGGACCTACC
AACGGATCCGAGAATGTTTCCACTGGAGGGGGCTATTCAAACGTGTACAATGATACGTCGGTGAATGCGTGGATTGCAAGACAGACGAGGGCAGACCCAC
AATCGAAGGGGAATTTCCACGGAACGTCCAGGCAACTTATCCGCTCCAAATCATAGCCATGGATCACATCCCCTCGCTACTGAAGCCATTCAAAGGAAAC
ACAGAATTGTTGATCTGGGTGGATCTATTTACCGGATACGTGATAGCCAAAGCCAGCGCGTCCAGAACTGCACAGACCATCGCCGAATTGTACGAGGAGT
GTGTGTTTTCGGAGATTTGGGGCTAGTGAGATGATTCGTCATGATCGGGGGAGCCAGGCTTTATGTCTGATTTTTTTCGAGCCTTTAACCGGATCCTGGG
CCAGAGACAGCGGGCAACTATGGCATATCGTCCCCAAGCTAATGGATCGGCCAAACGCATGGTACAGACGATCCCGAGGGCTTGTATGTTCAGGATTGGA
ATCCGAGGGATTGGGATGAGTACGCAGAACGACTCACCTTTGCGATGAACACTGGTCAAGACAGGATCCGGGGTGACACACTATTTTACTTGGTACGTGG
GTGGGATCCTAAATCCACCCTAGAAACGGCTACTCAGGTATGGAGCACCATGAAGAGAAACCGAGATCCAAGACGATGGCGATACCTAGTCCAGCAATAC
TACCGGCAAACAGATCCCAAGTGAACAAACGGTTACGAAGTGCGATTCAGGATCGAGCGGATCGACACAGCGAAGACGCCCGTCCACATCAAATTCAAGT
TGGAGCGCAGGTGTGTTTGGATCGAGTGAAGGAAGGATACGCCCGTAAACTGGCCCATCTCTGCCATGGACCGTTCCGAGTAAGGGAGAAGATAGGGTAA
CACGCTGTGAAGCTGAAAACGGCAGGTGCCGAATATCGCCTGTTCCCCGTGGTACACGTATCCAAGCTGTAGCTGGTCAAGGAATATCCGGACCGGCCGC
AAATCCGTCTCTCGGTGGATGAGTCCAACCAGGTGAATTTCGACGTAGTCCTCCTACCGGAAGATAGTTGGAATGTGGATCTCGAAGCCGACGAGTTCGA
AGTCGAGAAGATCTCCGACATGAGGTCAGGGAAGCGAACCAGATATGGGCGAATTTACCGCAAATTTCAGGTGTATTGACGTGGATATGACGAACCCAGT
TGGGTAGACGAGGCAGATCTGAACTGTGGAGCATTACTCTATGATTTCTTGCGAGATCGTACGAATC