Description :
From Genome Similarity Track
Location :
Scaffold_354:164- 3681
Sequence
3517 bases(100 bases per row)
GGACATTATTCCTTCAGCCCTGACGACGATGACGATGACGACGAAAGTCCGGAGGATTCAGAGGAGGCTCGAGTCGCCGATGATGCCTTGGAAGAAGACA
CACGGCGGGACCTGTCCCAATCCAGATCCGAAGCCCGGCGGAGATTCCTCTCGACACCGCCCCCGTAAGTCACAGACACGGCCGGATCCGGGGCCGGCAC
TGCGGGATCCGCGATCCAGATCGACAGTGACGGTGGGTCGGGTAGCGATGATGGAGGGGGATCACCTCATGGTGGCGGATCCCCTGGATCTGTCCTGATC
CCCGCCCCTTCTAATTCTTCTTTGCCAGGGATGCTCCCCGTGGCCCCGTTTGGTCCGGATGCTGTCTTCATTCCTGCTCGGCGCGCCCCTGTGGCCTTCG
CTACAAGAGACATTGAGCCTTGGTCCGCCAAGAAACTGAACCGGATCGCCACCGTCACTATGAAGATCACTGTCCTGTTCCCTGAGCTGCCATTCCGTGC
TGAGTGGATATTCCCTCGGGCAGAGGATGTCATCCCGACGGCCGGCTATGTGGATTTGCTCGTTACCAGATCTCACGTGGAAGAACTACAGGATGCCGCA
CCATGGGATACGTTGACGACCGCACTAGTGGATCCTGTTAGCTTCCGAAGTGACGTCCGCGGGCGTCTCGGATTGTTCGTTCGTGCGTTCCGGGATTTCG
TTTCCAAGCACCGGGTTGCCATATGGGAGGGCACTCACCGATTCCCCATCTCTCGTAATCAACTGCAGGGTTCGACTTGGTTGTCCAACTTCAACAAGCA
GCGCGGCAACCGACGTAGTCACGCCGGTCGGGCTTGGAAGAGAGTCCTTGTGATCCTCGTGTTGGCGATCCAGGACGGTTGGTGTGACGTGGATATTTTG
TTGGATCCATCCTTCTTGCACCTTCCTCGACGCTGTGGATAAGGTAACATGGTTTCCGGGATCCGTATCCCGTCAAGCCAACTTCGAGGATCCCAACCTC
CATCGCCCAGAACCCATGAACCTACTGGAGGCTTTGCAAGAGATCGATGAAGCCGAGCCTTGGCGTATCCAGTTTCGGGGGGACCCGAGCCAACACCCAG
GACACCAGATCCAGCGTCTATTGGGCAAGTTCTTCAATGTTCAGCCCAAGACCACCTGATCCCTATCGCCCTTTTCCGCTACGCCCCCAGTTTCAGTCTT
CGTGGATCCGCTTCGTAGTGGTAATGTGGTGTTGGAAATCCCACGTGAACTCTAGCTACAAATGCAGTTAGGACGTTCCCACAACAATACGTCTACTAGG
ATAGTAAGCGATCGTTCGGGCGGACCTGAAGACCCCAGTTCTGCCCTTGCACCGAAACAAACTGGACCTTGTAAACTACTTATATAGGCCAACCAGTAAA
AATAAAAACACGCTACTAGCACGAGCAAAGCTAGCAGGTGTTTTGAATCCTCGTGGTCCCAACAGCGGAAGGGTACCAGGCACGGGAAGGCCTTTTACGA
GATACCGAGTGTTCAACACTCGGTTGGAAGAATAAAAGGGAGGCAATTCAAGCACTCCCAGTCGTGCAAAATAGGCAACAATAAGCCGTCACGTAAAACC
TTCCTATAATAATCGGCCAATACACAAAGTCTCTTGGCCTTGCCGGATGAACCCTCGCTACCGAGCTTCGAGATCACCGACAGGCATAACACACTCAAAC
AAGCTTGACCTGACAGGCATAACACACTCAAACAAGCTTGACCTGACGCTTACCTTGAAGCCGGACGTCGCTCTGTGTGCTTGAGTGGAAATTCTGTTCT
GTATTTAAGCTTACCCTTTCGGGTCTATTCCTAATAAGAAGTCCTAATCAAATATACAAATATCAAGTGAACAATGATCCGTTATGGATCTTCTTGCATG
CCAAGCGTCGTCTGCACCGTCGCATGAGCATCTTTAACGGTCCGCGCCTTGTCCCAGACGGTGAACGTGCCTTCCAAGGGTCGCTGAGTCTTCCGCGAAC
TCATCCGAACCGCCGCTGAGGGTTCGTGCCGTAGATGGTCCGCTGAATGCGAATCCGGCCAGTCCATTATTAATAATAAGGACAGCCTGGATTCAGTGAC
ATATGGCCGTATCCAATACTCGTTGAAAGCTCGGGAGTGACGCCGTCGAGTCCCTTGCACCTTGGCGTCTCCGTACATCACATGACCAAGGGTTCGTTGC
TTGAACATCTTGGGCGGTGTCACGTCTTTGTCGACGGGTGATAATCCGCAACTACGGAGAAATTACTACACCACAACTGCCCCTGTCGCAATGGAAGCCA
CGGTACTGGTGCCCGTTGTGACATTTCTTCATTCTTCAATTCACCATCTCGCCACCGTATGTCCAAGCGTCTGAATCGAGCCGTGTCCGACGCGTTTCAG
CGTCTTAATCCTCGGAGACGTCGCGAACGTGAACAGCTGGAGGTACGTCAGCTCATCCTTCTCTTGAATCATCGGCACCTTGCTCATCACCTCGCATTAC
TCGACTTGTTTCTCAGGAGGGCAAGGCCGAGGGTTCGAACACCCCTCAGTCTGCTACACTTCCTCCGACAGCAGCGTCATCAACCGGCCCTCCGGCGCCC
GGTGCCCCGGACTCTTCGCTCCCTGCGGTAGCTCCTGCAACACTCCCCATCGTCGCTGAATCCGCGGAGATGGCTCCTGCTGCTTCTACTGCGCCTGCCG
GTGGTACACCACCACTCACCGAAGATTCGCTGCGCGCCATGCTGGCTGAAAGTACGGAGGCATCAGTCGATCACATGATGACCTCGATAATTCTGTACTT
GACTGCAATGGCTCGTCACCAAGTGCAGCTCAGCGTTGCGCCCCCTCTCCACGGCGATGTACACACTCAGCGTCGCCTCGAGACTGCTGTTGGTTTCGAT
GATGTTCTCGCGGCGGTACAACCTATTCCTGACGCGCTGTCGGCATTACCCAAGCGAGTCGCCGACTTGGAGCGTCAGCTGCGGTTTGCTCAGTCCGAGG
CTGCTGCCTGCGCACGTTCGGTGGTACCTGAAATCATGGCTCGTGAGAACGCGGAGGCGTTCCTCAAGGCTGCCAACGCTGAGATTGAAGCCCTTCACCA
CAACGTCAAGATTCTCCGCGAGTCGAACGCCAAGAACGACGCCATGCTTGCCACTGTTCAAGCCACTATGGAGCGACACGCAGAAGACTTGAATCGTCTG
CACTGCGAGGTCCAAGCTCGGGACGTGTTTATCAGTACGTTGCAGAAGAAGCTGGCTCGCGAACGCGAGGTGTACAAGTCTTCTATTGGAGCGAATACCG
AGCAGACTCGGAAGCTTCATCTCCTTCTGGTAAAGCTTGCCCAGGGCAAGTACGTTGATAACGACACGCTCAAGGTCCTCGAGAACCAGCAAGACCGTAA
CACTCGTCTCCTCCAAGCGAATCGTACCCTCCGTGCACACGTGAGTCTGGCAGGGATGGATCCCGAGGTACTTCGTCTGGCTGTTGAAGGTGCGCTCTTA
ATGTCGCTCCTTCCACC