Description :
From Genome Similarity Track
Location :
Scaffold_2844:164- 2750
Sequence
2586 bases(100 bases per row)
GGCTCAGCCCCGAAGAGAGCTGAGCTCTCTTACGATAAGAGTGTGTGCAAGCCGGGCTTGCTGGTCGTTCAAGCGAACGTGAAGGGCTTTGCAAAGCCAT
GGAGAGTCTTGATTGACTCGGGAGCCTCGGGCAACTACGCCCGTCGCTCCACCCTGGAAGGGAGTCAGCTGTATGCTGAGGCACTGGAAGTGCCAACGAG
AGATACGATCTCTGTCCGTCTCGCGACGGGGACACTGGTAACTGTGTCGAAGGTCTCTGTCGACCTTGGAGTGAAGTTTGAGAACTTCGATAGCGTGGAA
CGCTGTTTGGTCTTAGACCTGGATGCGAGGTATGACCTCATCCTTGGCATGGCATGGCTGGAACGTCATGAGCCATGGATCGACTGGAAGTCGAAAACGC
TGGGTGCGTCGCACCCTGCTCCTAGTGGAGCTTTGGTGAGTCATGAACCCACCTCTGCTAGGAAGCAGAAGCGCTTTTGGCGCGAGCACGAGGCTGAGGC
GGCCGTAGTGCTGGACATTGGTATGTCCTTAATTGTTAGCAACGAGGTTGCTGTTTGCCCTGAGGGCGTACGTGGTGCGGCACGTTATCCGCGGAGCGGT
GCAGGTCAGGTCAATGACCAACTGCTGGGTCCTGGTGAGGACGAGCGCGGAGTGGCGCGTAATCCACTGAGTGGTATGAATCTGGTCGATGACCTACCGC
TGCGTGACCCGAAGGTCGCGGTCGACTGCGAGTCGAGGCATCATGGGCGTGGCCCAGGAGATGCAGGTGAAGTGACACCTAGTTCACTGTGTGAAGGTCA
AGAACCTCTTGGCTTTCAGCCGAGTGTCTTGCGAGACACTGTATCCTCTTCGAGGAGTGATGGTGCTGCTGCACCCGGTGGTGGTGACGGAGATGTCGCC
ACACCGCCCTCATCCGGCCGGGCTCGGTCGCGGAGGGAGAGGAGAAGAAGACGCAGGGTGTCTGTGACGTCTTCGACGTCGGACGATGTGTCCAACGTGA
CGAGCGGTGATGCTCCACGTGATTGCTGTGAGCAGCTGTATACACTCGTGAACGGAGTGACGGGGGAGGTAGAAGGCGATATCAGCCTTGATACTCTGCC
CGCTGCAGATGCTCTGCTAGAGCTGGACGAGATGTCCATTGCCGAGTTCGGCGAAGCCTTAAAGGCAGGCGAGCTAGCCGAGGTGGTCTTGCTGGGACCT
GAGGAGGAGTTGAACTCCTCATCCGTCGTGGACGACGCGGTCCTAGAGGACACCAAGAAGGCGCTGAGCGCAAGAAGTGGATCGGCGATCCTCAAAGATC
CTTCGGATCCCTTCTACCCGGTGGTAAAGGCGTATGGAGACGTTGTCTCAAAAGACCCACCGACGGGCCTGCCTCCGGATCGAGGCGTGTGTCATGAGAT
TGACCTGGTTCCTGGAGCCAAATACTGCGTAAAAGGCAATGGCCTTTGCCGAGAGAGCAAACACAAGATCGCAAGCGTCAGGTGAAGGGGCCAGTGCCGA
TGCACAGGCTGAGTCAGCCTCCCTTGCTACTGATGCTGCATAGTATGCGGCTGGACCTTAGACTATGTCACAGTGTGACGTCATTGACGCATTCTTCCGT
GCGAAGCACGAGGCAGGGATGGTGCGTGAGAGCAAGTCTCCGCACTCGACACCCACGTTCTGTGTCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATG
CTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAACATGGTAGGCTGTACGTTGTACAGCGC
GCTCGACATGGTCGATGGTTACTACCAATTGCTCATGAGAGCGAGCGACATTTCGCTGACAGCGGTGAGTACTCCGAGCGGTATGCTCTGGAAGTGGCTG
GTCATGCCCCAGGGGCTGTCGAACGCACCAGCAACGTTCAATCGTCTTGTGACGCAGCTGTTTAGGCCCCACCGGGCGTACGCTCAAACGTTCTTGGACG
ATATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGACGTGGATAACCACATTGACCACTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGTT
GTATGCCAACTTGAACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGCTTCATTGGGAAGCGTGGCTTACGGGCAGATCCTGCCAAAGTC
AAGGCCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCTTAGCCAATTACTTGCACAAGTACAGTGCGAACTACGCGG
AGATGGCTCGGCCATTATCAGATCTCCTTGAGAAGGACGCACCATGGTGCTGGAACGTCGAGCACGACGGAGCCTTTGAGGCTGTGAAGGAGAGCCTTCT
CCGGGCTCCGATCCTTGCGCTACCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCCGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGAC
GCCGAAGGGCGTGAACGCGTGATCGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAACTATCCAGTTCATGACAAAGAGCT