Description :
From Genome Similarity Track
Location :
Scaffold_2338:164- 2340
Sequence
2176 bases(100 bases per row)
GCTGGGAAAGATGGGGTCAAGGAGAGAAAGGGACGTGCAGCCCGAGCCTGTTAAGGAATTTTAACAAGTGGAAAGACCTAAGAAGGTAGGAAATCCAGGC
AGGTATAGGCTTTAAGTATCAATACAGACTTCTATTTGCACAATAACACGCAAGTGCCTTTCTGCCCTCAAGAACCGGAACTACATTGGCCGTACGAGCT
CGGAGAAGGTTAAGAATTGCGAATCTAGTGTTGGTAGTGATAACTGGATAATACATTGGCCAGATCCTACAACCTAGTGAGCTTTTCTTTTACTTGTGCA
GATCCGACAGGTTAACCGGATTTACTACTTGGTCGGTTACACCCTAGAGGCTCTCAACTTTCAAGATCCCGTCACAAGGCGGCAAGTACGACGCAAAGGA
ACTACAAAGGCAAGGGAACACACCCGTAAGGCAACCCTACGGCCAGATCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATTCGGA
ACAATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAG
TTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCTCCGTTAGTCGGTGTC
TGGGCGCAGTTGGTAAGTTGGATCCAGCAATCTCGCAGATTTTGCTGATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGAT
TTCACCCTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAG
ATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAGGTGGATCCGGATCCGGATCTAGAAGAGAAACCTCTCTATCCTTCCCAGGTC
CCCTCGGGTCCCCTGCAGATCTAGACTTGCGTCAAGATCCGCTAACAAAACAAAGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGTTTAA
GCCAACAGCGTACCTAAACCCAACCCCGCTAGTCGAAGAAACGAGAAAGAAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCG
GAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTCGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTG
TCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACCGGTGGGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATT
ACGTCTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTC
GTTGCCAGAATTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGATCCAGTGTCGTCACCGAGGATCAGCCAAGCTGCGTCCTCGAACTACGAATCCG
CCGCTGAGGATGAGTCAGACACGTCGTCCGAGCCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGATCCGAGGACA
GGAAGCCCCTGTGAACGTGAAGGCTCGGGATCCAGTACGCCCTACCCGTGATCTGATACAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTG
GGGTTATCGTCAGATCGGACTCAAGGTAATCGCCTCACGGATCCTGTCTCGCCAGTGGACCAGCCGGCCACAGGCTCTTCCGACACCTCCTCAGGCACCC
TGCAGCGACATTTTGAAGCTGCGATGAGTCGCTTCCTGGCCGAACAGGGTATGAGAACTCCTGTGCCACAAGCGCAAGTGCTCCACGAACATGGAGCACG
AGACGTGGAGATGGAGTCGGTGGAGGGAGACAACTCCCATGATGAGTTCGACCCAGATGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACA
GCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGATCGGAAGGAGTTCA