Description :
From Genome Similarity Track
Location :
Scaffold_2399:164- 1669
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2399-snap-gene-0.1Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_2399-snap-gene-0.2ATP-binding Cassette (ABC) superfamily

Sequence
1505 bases(100 bases per row)
TTGTTCTTGGCGCTCTGGGGTCAGTAGCAGGAAGAGCAGCATCTCCATGAACTTCGTTATCACCGTGCTATGAATATTAGAAGTTCGAGTACTTTTGAAA
TCGGCTGTGAGGGTGTGTACTTATGTAGTGTTCATCTAGTCCGTAAAGTACAATGCCGCATGCGTTTCGTCAGATCGCCACTTGCAGTCTCTCACCTGTC
GGTCGCTTTCGCCATCAATACAGAGCAGTTATTTTTGCTCCCGGCAGCCCTGCGATCGAGTGATTGACTGCTCACACTCCAAGCAAGCGCCAACGAAACA
TGGCGAGCCACCTCGCGCACCGCTTTCCGTGGGTGTCTCTCGGCGACGTCATCAAGTTCAAGAGAACTTCGACAAAAGGCGGGGGCTGCGTGGACCCGGA
GCCAAAGCACGAGAAGGTCATCGCGCACTTCGCGCGCTGCGTCACTGACACGCTCCAGGAATTTGCTGCGAGTGACAAGTCGCCCGACGAAGAGAGACGC
AAGTTTGACGCGACCANNNNNNNNNNAGGGATTGACGCCAACGGCTTTGGCGGTTACATAGGTTACTACACCAGTCTTCTCTGCGGGTATTTCCAGCTGA
ACCTGATTCTCATGGACCCGAAAGAGTTTACTCCGATCGTCCTGCGTGAGGACCAGAGTGCGACGTGGGTGATGCAAGTGCTCTGTGGAGATTGCGACGA
CGGTCACCTGGAGTGGATCGCGAGTCATCTCCGCGGCNNNNNNNNNNCGGCCACTGCGCGCTGCTCTTCCGAGCACTGTACAGCATCAGCGGAGACAACT
ATGCGCTTGACCCGACGCTTGTAGAACAGCGTTTCACGCTAGGCTTCTACTAGGGTGCGGAGATACCGCGAGTCTGAAGAGCTGTCTCTGTATGGGTAGC
AGGCTTGGAATCCACTTTGTGCCTCAACAAATGGACATGAACTATCAGAGACTACGCTGACGTCAAACGACAGCAGCTGAAGCGAAGAAGACTATTATCT
TACATCTCCTACGCAAGCGCCCGTTCTTCTCGTCGTCACTATACTGCAGTTACCTGCATCATGTAACGAAGATCAACCGCATGTTATTTAGTTGGCCGAC
GTCTCGATCAACTTTGTGTAGATACCGTTGAAAGCGAGCAGCTCGGCGTGCGTGCCTTCTCCCCCGATCTTCCCGCCGCTCACGGCACAGATCTTGTCCG
CCTTGCAGATCGTCGACAGCCGGTGAGTGATGATGATTGTCGTGCGGCGCTTCAGCACCGCGATCTTGTTCAGCGCCTCCTGCACGACCTTCTCGCTCTC
CAAGTCCAGTGCGCTCGTGGCTTTGTCCAGCAGCAAGATCTCGGGATTCTTCAAGATGACTCGCGCAATTGTGATGTGCTACTTCTGACCGCCTGAGAGC
TGCTCGCCCTTCATGCCGACCTGGGTCTCGTAGCCGTCGGGGAAGTTCAGGATGAAGTCGTGCGCGTTCGCGATCTTCGCTGCCGCCTCGATCTCTTCGT
AGCTG