Description :
From Genome Similarity Track
Location :
Scaffold_10:16399- 19262
Transcript NameFunction/comments
Physo_130046hypothetical protein

Sequence
2863 bases(100 bases per row)
TTGGCGCCATTTTCCTGAACCAGAGCACTCTTCGCGCGGCCAAATCCGTCCGAATGAGAGAGCAGTGGGAAGCTGTGCAGGCGGGTCTCCGCGTGTTCTT
GGAGGAGGAAAGCGCATATGTTCAGTTTCTAGCGAATATCGAGCAGGAGCTGGCGCGGAAGCTTCGGTTTGAGGCTCGGTCGCGGGACGGATCACTCGTG
GATAGCGACTTCGACCGGTTCGTTGAGACTGCAGCGCAGCTCCAGTACCTCCACGTGCTATTCCACTCCAAGTTGAAGCCATTCGCGGAGCCTCGAGCTC
GTGGAGATGTCAGTCCGGCCGACGACAAATGCAGCCGCTTCGTAGAGACTCTGGCAGACATGCTCAGCGTCCTCCGCATCCTCTACGGGAGGCTATTTTG
TAGAGGCGACTCTACCCAAGCAGTGATAGAGAAAGCATTGACAAGACAAGACAAAGATTCAGACGGAACTGTGGTGGAGAATTTCCTGGCGAAGCAGCAA
CTGACCGCCGAGAAACTGGTAGCTCGTCCGTTGAAGCGATTCGACGAACTCGTGGAATTTGTCGAAGCGCTGAGCAAGGCCTTGTCCGAAGATGACAGCG
ATGAGATCATGAGCAACAACAGCGAGTCAGGCTGCGAAGAGAAGCTGAACTACGCTCCTCAGCTGATGCACATTGCCCAGGAGAACAAGCACTACATTCA
CATTGCCAAGGCCGACGCACGAGAAGAGAGCGAGTTAATTGCGTTGCAGACCTGTTTCCACGGTGACGGAGCTGATGAACTGAGAGATTTGTCCAGCAAG
AAGCTGCTTCTGCATGGAGGAGTATTTTTGTCGGTCTGGAGTGCGCAAAATGGTAGCGGAGTGGATGGAGAGGCAGCCAGTCAACCCGAAAGGATATACG
CGCATTGCTTCGAGGATGGAACACTTGTCTGCAGCAAACTGCAAGAGACTGAGTCCGGGGCATCTTTCACGATCAAGCATTGCCTTCACCTGAAGCAGGA
TTCCGCGTTTCTTGAGTTTGTTCCAGCCAGTGTTCCAGTGCTTGAATCAACTGGGGAAGCGCGCGCGTTGGCATTGATTAGGCAAGATACAACACTGCTG
CTTGCTTGGAATGACGCTGCAACGAGTCAACGATGGGCCGATGCCATAGGAGGATTTCTGGAGATGAACGGATCACGGAGCGATGCACTTCGCCTAGGAC
GAACGATTGACGACATCCCAGTTCCTGAGGAGATCACTGCACAGCTTGGAGAAGATAGCACGCCACCAAGGGAGTTTGTATCCTTTTACGATGACCAGCT
TCCTGGCGTTTTCTGGCTAGCACCTGAGAACGACTCGAAGACTAGTGAGGAGTGGTGGCAAGTGGTTGAGATTGTATCCTATGCAAAATGGCTGTTGGTT
TTCAAGCTCGATGGCTGGAAGGGGCATTCGCTGCTGTGTCAATTAGATACGAGAATGCCTGGAGTGGAGATTTGCGAGCAGCCACGAGGAGACAAGGAGT
GGAGTTTGGTCATTTCCCCTGGATCTGCGGCTAGCATCACGCTAGTATCGAAGAAGCGAACCAGAATTGATTTTTGGTTCGACCAAGTGTGGAAAGCTGT
TGAGAGCGCTCAAATCGCGGCGAGGCGAGCTGAAAGAGAGAGAAAGGAGAGGGAAGAGATGGAGGAGGAAGAGGCTCACGTCCGTGTGGACGGCAGCAAA
CAAGCAGGAACGAAGCGGAAGCTCGCCACATGTTCCAGCGACCAAAGCCCATCTGAGCATATGAAGAAAGCACAGGAGCCTCGCTCTAATTCTAGCTCGG
CTGCCTCAAGTGGCTCAAAGCCGGATGATAAGACGGATGATGAGTGTGGAGACTTGGAGAAGAGCGCTACAGCAAATTGCGTCGAGGAGGAGCAAGCTGC
TGCACTTTCGGCTAAAAAGAGACCCAGGCGCTCATCCGACAGATCGTCGAAGAAGACGCCAAGCGCAGCCCCAACTGGGAAGGATGACAAATCCACGCAT
GTTGCTACACCGCCTGTGAAAACTCCGAAGAGACGGTGGCTCATGAGGAAGTCGGACGATCCCAATGACACTGACCTGATACCAACTCAACCAAGCCAGA
GCATTCCGACAGATGAATCAATGAGCGAGACTGACGCGACCCAGTTACCCGGCAATGAAGTTCAGGTCGGTGTCGAGGCGACGACCCAAGAAGTGCGGAT
CATCCTTACGGGCGTCGAGCCCACCGCTTCCATCCGGAAGAAGATCGATTCTATCTCGGGGGCCGTTTATGAAGAAGACATCGAGAAAGCGACCCATGTC
CTCGCCCCCAAGAATCAGTTGAAACGAACCGTGAAGCTGCTGTGTGGGATCTCGCGCTGCGCCCACGTTCTAGACGTGCGATGGCTGGACGAGTCGGCGC
GTGTGGGTGCCCCTATATATGAGCGAGCACATTGCCTGAAGGACGCGAAGGCTGAAGCCAAGTGGCAGTTTGACCTGCGCAAGACCATGTACGACTTCAC
GCCGGAGCAGCGACGGCAACTCTTTGCAGGTCACAAGGTGTTTATCACCAACCACAAGTCGGTTCTGCCACCGGTGAAGGACCTGGTGAAGATCGTGGAG
TGTGCTGGCGGCACAGCAGTGACCAAAGGCAGCGCCGGCCCCGACGATGTGGTGATCACGAGTGAAGCTGCGCTGGGTATGGCCTCGGTTCGGAAGGCGC
TGGCACAGGCGAACCCGCAGCGGATCTACTCGGCCGAGCTCATTTTGAGCGGCATTCTGCAGCAGCACATCGACTTTGACAAGAACCGCCTCGAGCAGCC
CGGTGGCGGCAATCGGCGACGCAGGTAGATGCCCGAGGCTCGACAGGAGCTGTAGCTAAATGA