Description :
From Genome Similarity Track
Location :
Scaffold_26:163978- 165804
Transcript NameFunction/comments
Physo_133434hypothetical protein

Sequence
1826 bases(100 bases per row)
AACCAAAGACGAGGACGCATGTCGGACTTCTTTATGCGGCAATTGGTCGGGCATCCGGGCAGTGGCCGACGATGGTCTGGTAGACCATCGAGCCACAGAT
CTGCGCGCCCATCTTCTTCGACTTGGAGAACCGGCGGATGTCCGGAGACAGTTGAGTCATGCTCGCCGAGTGCACCTTGGTGCAAATGCTGCGGCACACG
ACGCGCTCAACGCCGTCTTCACAAACCTCGGGCCGGACCACCACACTGTGAAACACAGCAGACAAGCATGTTAGCGCCATCCACAGTAGTAATGAAGGCA
GAATAGATGGCGACAAACTTACGTTCCGATGACGTCGCGCTTGACCAGCGTATTCTTGTTCATCAGGTACAGGTCGTCGTCGTCAGCGTAGTCCCACACC
AACACTGCGCATCGATCCATGATCTTGTAATATGACAGTCCACGGCTCTCGACAGCCACTTCGTCCTGGCCGTCTTCGCTGCGGTAGCGGCACCCTGAAA
CGCCATAGCGAATACTGTCGGAAGGCGAGTCCACAACCTTTCCGTACGAGTCCAGCTGCGTGTAGTTGGGCCACGCACTGCCGCATCCCAGAATGGCCCC
ACACGCAGCAAGGAAGATCTGCACCGTGTTCATCGTGTCGAAAGCGTACACTGCCACAGTGGACGCGCCGAACTCCGTTGAACTCGTGCTGATCTGTCGC
GTGCTGATGTGCGGACGCAGAACTGGAATGCCCTCAGTCTCACGCAGAACCGTCTGCATGCCCAGCTCCAGCTTGGCATCCGTGCAGACGGACACCAAGT
CGCGCGTACGAGACTGCGGATCTTTCCGCAGGTGAGTGTAAGTGTGCAGGAAGCGCCGCATGTTGAGCTCCATGCTGTGTGACGGCAGGCCAAGTGAGAA
CATCGCCTTGAAGTTGTTGAGATAGCCACTCTGCTGAAATAGCGCGTAGCGCAGCTGCATGTTGAGTTCCTCGGCCTGGCGGCGCTTGTGGCGCTGGGCG
ATGGCCTTCTCCTCCCACTCGGCCACGGCTCCATCGGCACGCATCAGCTTGTGCTTGGAGCGCAGGAAGTCCAGCTGGTAGTTCAGGTAGCTCGCCTCCT
TCTTCAAGTTGATCATCTCGTTCTACAAGCAGCAGGTAGCACAACAAATTAGCTCTCTCCATTCGATCTTCTGTACCGTCCAATACACAGGCGCAAGCAC
TTACTTTCTTGCGGGAACGGTGGCGTCGTGCACTGATAGCCACCTGCGCTCTGCGCTTAGCCTTGCGGTCCTCCGCCTTCTTGTCCCCGGCAGTCACCGT
CGCAGCCTTCTGCACGGCCACAGATGTGGCAAGCTCTGATGCATTCACTACGTCATCGTCATCGTCGCTGCTCTCCGTGGTGTCGCTCCTTCCGCCGGGA
GACGACACCACCAGCTGCTTCGACGACGTCGTCGTCGAGAGCGGCGACGTCGGCTCGGGGACGAGCTCCTCGCCCTGGTGCAGCAGCTCCGACAAGAAGC
TCAGGTCCAGGTCGTCCACAGACGCGCCGAGCATGGCGCCGCCGTCCACTGAGCCGACGTCCAGCAGCGTCAGCGTATCGTCCAGTCCGTCCACCGCGCC
GTGGAGTTCCATGTCCGCCGCGTTAAGCAGGAAGTCTGTAGTCGTTGGTTGACACGGCAGCGAGGTGAGTTGGTTGTGCCTACTTAACAACAGCATCGCG
GTACCAACCGCAGCGGTGCTCACCTGGCTCGATCGATGCCTGGCTCATTGTTCTAGAAGGGTGCACTCGTCCGGATCACTTTGGTCTTTGAGGCAAAAGG
AAGAGTGCGGCGATAGGCTTTCAGTA