Description :
From Genome Similarity Track
Location :
Scaffold_27:163964- 165343
Transcript NameFunction/comments
Aphas_H257_10730Amino Acid-Polyamine-Organocation (APC) Family

Sequence
1379 bases(100 bases per row)
CGTCTTTGGACATTTGGTAAAAGATGCGCGGTTGGCCCATGAGACACGTAAATGCGGCGGTCGTGAGGCCAAACATGGACCCGAACGACACGACGTGGGA
GACCTACACTCTGGAATCAGACTCTCCATAAACAGATGGTGAAACATGATATGTCACGATGACATACCCAAGGGAGGTGTTGATAGTCAAACGCGTTCAC
GATGGGCACGTCTGTGCCCAGCACGGCCACGGGCGCCATGCTACCCCAGCCCTCCATGAGACCCCAGGATACAGTACGCGGCATAATATGGACAACGAAG
GTGCGTACCCTGTGACAACCAGGGACACGCCAATGTAGATGGACATGGAGATGAGGAGCGACCCGATGATTCCGCGCGGTACGTTCGTCTGGGGGTCGGG
CACTTCCTCGGCCAAGCAGGCCACCATGTCGAAGCCAAGATACGCGAAGAAGATGACGCCCGCGCCTTGCATCACGCCATGCACGCCCTGACGACAACGA
AGAAGATGAGGGGGTCCATTGTCCTCTTGATGACGATCCATCGTACCTCTGGCGCGAACGGCTCCCAGTTGGCCACGTCCACTTGGGTGCTCCCCACGGC
AATGACCAACACCAGGACGGCCACGTTCAACCCCGTAACGACCATATTGAATTTCGCAGACTCCTACGCTTTACTATGACACAACAACGAAAGTGGAGGG
CTGCGTACGTGCACCCCGGCGAGCAAAATCACGCTTAACACGACAATCAAGGCGGCGGCCATGGCGCTGCAGCTCATGCCCCACACGTCGACGGTGATCC
ATTCGTGGGGGATTTGGATGTTCCATTGCTACATATGTCATCTTGTAAGCATGTCGAGAATGATCACAAGATGGTCAGAGCTTGTGTGAACGCACCCGCA
TGAAGATGACGACGTACGACGCCCAACTCCGTGCGATGCCAGCTACGCCATAAGGTGACGACGTGGACGCAGGGATATGGAGTACCAGCGGAGATGCCGT
ATCCAAGCATGAGGTTCCACCCGATCAACCATGCAGCCAATTCCCCAAACGTGACGTAGACAAACGAATATGCAGACCCAGTGATCTAATGCACGAAGTT
GAGGAACGAGTACGGACGAGGCAAACACCATACCGGCACTCGCGCGGCAAACTCCGAATACGTGAGTGACGTGAAGATGCACGCGATACCGCTAACCAAG
AACGAGATCGAGATCGACGGGCCCGTGATGCTTGCGCCGATGCCGATAAGCGAGTACACGCCAGCACCAACGGAGCATCCGACTCCGTAGCAGATCAGAT
CGAAGAGGGAGAGACACCGCTTGAGTGACGCCGTGTGGTCGTTCAGGTGGAGGTTCTTCGGCAGGGGCTTCATACGACC