Description :
From Genome Similarity Track
Location :
Scaffold_918:16391- 17424
Transcript NameFunction/comments
Phypl_g11639hypothetical protein PHYSODRAFT_340908

Sequence
1033 bases(100 bases per row)
CGCAGGTAGTCGTACAAAAAGCCTCCGCAGGACAAATTTAACGCTGGTTCCCACGTCGGTTCGTCATATCCGACCCACTTCATTTTGAACTCTCGGACAG
CTCGTCTAGTGTGGGTTGACAGCGTAGTTCGGTCATCGAGGACGACCTCAACCTCAAATTCGCCAGAGAGCCGATCAGACTCCCAGCTATCTTCGGGAAG
caactcctcgtcgaagtctACTCGCGTAGCCTCGGTCACCTCTGGTGCCAGTCGACGTTTCGATCGGTCTGCGTATTCGTTCACGGCTTTGAGCCGAGAG
ACGTGCACCACTGGGTAAAACCTGTATCCACTTCGATCGGGTAATTCCAACTCGTACGCAAACTCCTCGACTTTCTTCTTCACCCGGAAAGGTCTATGCC
ATCGGTGGGCCAGTTTCTTAGTCAGTCCAGATTTCACTCGTTCCATACTCTGTCCGCTGGTTGGAAAAGAGACCTCGGTCTCGCGTCAGGAGCGTCGTCA
GCTGCCTCTGTCTCCAATGGAGTATCGTCCGACGTCTCGTTCTCAGCACCAGTGATCGGTACCGCCGCTCGTTCACGTCtcccaagcagctcgttgtgTT
TCTTCGCTCTCAGAGCTTTCTCGGTGGCTTGGTATTCCATAGCCATTCTCCACGAAATCTCCTGCTGTCGGTTCACCTCTCAGCGCCACGCAAGCGCGTG
GGTCTGGTCCCCAGAGCCTCGCtggatcgacgacgacattgCTCGGAGCGTGGACTGCGCATCTCAACCATGAACGAGGTAAAAAGGAGTGTCCTTCCTC
GTCCCGTCTTGTGAGTTGTTGATAGAGAAAATCAGTCGCTCGGCAATCTCGTCCCAGTCTTGCTGCAAAGGATCTTCGGCATAGACGCGTACAGACTGCA
TCACTGTCTTCACCGACCGTTTCTGCTGACCGTTCGCTCGCGGCCGATAGCTCAAAGTTGCTCTCGACCGAGACTGCGTCATCTCGGCGAAGGCTTGGAA
AACCTCGCTCATGAACCGTGGGTCACGGTCGTG