Description :
From Genome Similarity Track
Location :
Scaffold_355:1639- 4652
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_355-snap-gene-0.20Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_355-fgenesh-gene-0.2Cytosol aminopeptidase

Sequence
3013 bases(100 bases per row)
ATTTGCCCACCTGCAACCCGATCGCATGCACGAGGTGCGGTGCAAGTGCTTGGCCCAGACAAGAGAGCGTCACGGCGCCCGTTGCGCTTCCAACGACTCG
ATTTGCGTGGTCTTTGAGCTCCCACGTGCCGCTACTGCTCGCCCATTCACACACCCGGAATCGCATCTCAGTCTGCATCGACACTGTCTCGTGGCCATTT
TTGCCTTCAGTCGCTTTACGGAGCAGCCCCGCATGGATTTCAATGGGGATGCTCGCAAATGCCACGAGACGCGCTTTCCCGTGGTCCTGCTGCATGACCA
GCAGCGCCAGCGGCGCCTCGCATTCTCGCTGCAGATCCATTGCCAAGTGGTCCGCATTGGTTTCAAAGAGACACGACTTGCCGTGCTGAAGCTTCATGGC
GATAGCGCCACCATCATTACTACCTGATAGCTCTTGTTCGTTATCTGTAGCTGCTTGGGCAATGCTCAGGGCGTCGACAGGATCAAAGAGCACGATTTCG
TACTGGAGCAATTGGAAGCCGACGAGGAGCTTGGCGTCATGGCCTGCGCTCTGCCCGGCGCTGGAATGCGTAGGCATGAGGAACAGACTGAGGTCGTTGA
GATAGAACTGCACGGAGAACAGCAGCGGCGGCGCAGCTACCGCCATCTTCACACCGCCTTCCTTCTCCAGCAAAGACTGTTTTAGCTTGATGCCATTGTG
ATGGTCTGGTTATGGGGACTAATATATTCTCGTAATTTATTTGTGTTGGTGCCAAAAAAAGTTTTCGAGCCGTACCAAGCCAAGCCAAGTTTTCTATATC
TAACCAGCATTACAATTTCAGCCAATCATTTATTGTTCATTTATTTGTAATCAAACCGGTACCATATATTGCATTGATCAAAATCATACATTGCATTGCT
GCATTGTGTCCGATTCACCGCACATTTTTGCAATTGGGACGAGATGGTGCGAGTGATGACAATGACGATGGCACCGCTGCTGCGCGCGCGCACGGNNNNN
NNNNNNNNNNCCGCAACGCGCGCTTCTTGAGCGCAGACGTGGCGCACCGGTTCGTGCAGCAGCGCGTGCAGGGCGAAATCGCGCTCGTGGTGCCGAACGC
CGAGCAGCTTCCGTCCAAGACGCGCGTGCTGTTTGTGACCAAGGCCGAGAGTGATGCGACGGCAGCGCTCCAGGCTGCNNNNNNNNNNCCAGTGTCCATG
CACGCGCTCAAGGACTTCCACGCCAAGCCGCAGGAGAAGTTGTACCTGTACCCAAGCAGCGACGACGCAAAGTATGAGAATGAGCGCGTGCTGCTGGTCG
GTCTCGGTGCGGCCGACAAGGTGAACGACGAGCTGCTGCGCAACGCCACGCACGGTGCGTTGAGTGTGCTGAAGGCCAAGCGCGCAAAGGACGTGGTGCT
GCAGCTCCCAGAGCTCAAGGATTCGACGCTGAAGCAAGAGCGCGTCGTCGAACTCGTCTCGCAGGTAGGTGGTACTCCCAGGTAGAAGAGCTTGGAAGGA
CACGATCACCATTGACATGGCGTTCTTCTTTGAATTGTGTAGGCGTCGATTCTGTCCAACTACCAGTTTGACAAGTATCTGAGCACTGACAAGGACGAGA
ATGGCGAGGACAAACTGAAGCTGCCGTTGGAGAAGATCTTCTTGGCTGCGAGCGAGGAATTCCAAAAGGTAGGCAGGCAACTTTGCTTTTCCTCAGTCCA
GATCGCACGAGGCATTTATTCTCACTCACGTCTTTGTTTTTGTTTTCACGAGCGCAGAACGTGACGGAGCAGATCACGCTCGGAGAAGAGACCATCTTTG
CGCGCAACCTCGGCAACGAGCGCTCGGACGTCGTGGACCCTGCGTTCATGGAAAATATTGCTCGCGCGTCGGCTGATCTCCCCAATATGTCGTTCCGTGT
GCTGCAGCGCGATGATCTGGAGGCTGAGGGCATGAACATGTTTCTGAGCGTCGGTCAAGCGGCGACGTGTCCACCTCGTCTCGTGATCCTCGAATACCAT
GGCAACCCGGAATCGGATGAGAAAGTTGCGTTGGTCGGAAAGGGTATCACTTTCGACACTGGTGGCTTGAACCTCAAACCATCGGGCTACATTGAGGACA
TGCACACTGATATGTGTGGCTCCGCTGCCGTCCTTGGCGCTGTGCGTGCGGCCTCGCGTCTTGGACTCAAGGTGAACATCGTGTGCGCGTTGGCGCTCGC
GGAAAACGCCATCGGCTCCAAGGCCGTGAAGCCACACACCATTGTCAAGTCGCACAAGGTAAAATCACAAGTAAATGTGACGCAAAAGCAAATTGGATAC
GGACGTGCTTAAAACGTTACTTTTCTGTATTTTAGGGCATTACGGTGGAGAACAACAACACGGATGCCGAGGGACGACTCGTGCTGGGCGATGCGCTGTC
ATACATCCAGCAGCAGTACAAGCCAAAGAAAGTGATCGATGTCGCGACGCTGACGGGAGCCTGCATTGGTACGTATTTACCTAGACTTTGTCTTTTCGTT
GTGGACGACTGACCAGATGATTTCTGTTGTGCTCTTGCTTCAGTCGCTTTGGGTGAACACTGTGCCGGAACGTTCTCCAACTCGGACGAGCTCGCGCAAC
GCTTGCAGGTAACACCCTTGTGTTTAAGTTGCTGTCATCTTGCTGATCCGGTACTTAAGCTGACAATTCACTGACCATTCACTTATGTCTCGTTTGTTGC
ATTAGGAATCGGGGACGCGCTGCTACGAGCGCAACTGGCGCTTGCCGATCCTCCCTGAGCACTCGGCTGAGCTCAAGGGCTCGCAATCCGACTCGCGCAG
CACGGGCAAGGGCCGCTACGGCGGTGCGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGTTTATCGACAAAGACGTCGACTGGGCGCACATCG
ATATCGCTGGCCCGTCGAACTACAGCGTGCCGAAGTCGTACTTCCCGAAGGGCGCCACAGGCTTTGGCGTGCAGTTGCTCTACACGTACCTCAAGGACTA
TGAGCAACCCCAG