Description :
From Genome Similarity Track
Location :
Scaffold_7:1638702- 1646529
Sequence
7827 bases(100 bases per row)
GCAGTCTCGGTGGATGAGTCAGCAAATGCGGTCGCACCGGACAGCGTACGTTTACGTCCGCTAGGTGCTGAACCTAAGTCAGCTCGATGGGAACGATTCC
AAGCGCAGTCCTGAGAGGCCTTGCGGGAGTCAGCGAATCCCGTATACGACACCGCCTGCGAGTACGCCGACGTCTTCCCGGATGAGATTCCCGCGGAGCT
ACCGGCGGATCGTGGGGTTCAGCATGAGATCGACCTCGCGCCTGGTACGAAGTACTGCGTCACCAGACGATGGTCACTTACTCGTGATCAAGTGAAAGCG
ATCGATGACTTCTTCGAGGGCCGCCGAAAGGCGGGTCACGTGCGTGAGAGTACCTCTCCGCATTCCAGTCCAACGTTCTGTGTGAAGAAAGCAACAGGGG
GATGGCGTATTGTTCACGCATTCAACAAGTTGAATGATGCCACCATCCCCGCGCAGACTCCAATCTTTCGGAAGGACATGGTACTGGACTCAATGGCTGG
CAGCGTCATTTAGAGCGCCATCGACCTGACCGATGGATTCTATCAGATCCCGATGGCAGCATCTGATGTGCCTCTCACCGCCGTAAGTACGCCGAGCGGG
ATGCTCTGGGAGTGGCTCGTGATGCCACAGGGTCTGAAGAATGCGCCTGCCACCTTCAATCGCATGGTCTCTCATGAGCTTCGGTCGCTCCGAAACTTCG
CGCCGAGTTACTTCGACGACATCTTCATGCACAGCCGCGCTGAGGGGAACCTCAGTGCCGTCGAAGTACATCTGAAACACCTGAGGCAAGTCTTCCAGGT
GATGCGAGAGAACGAGCTCTACGCAAACCTGAAGAAATGTGTCTTTTGCGCACCGGAGATCCCGGTGTTGGGATGCTACGTGAGCAAGAACGGTGTGCGC
GCGGATCCCGAGAGGGTATCGTCTATCTGTGCTTGGCCAACGCCGACAAGCCCCACTGAGTTGCGTCAGTGGCTTGGCATGGCCAGCTACTTGCACAAGT
ACACGAAGAATTACGCTGAGTTGATCCAGCCGCTGTCCTCGCTGCGGAAGAAGGACGTGATCTGGGAGTGGAAACCAGACCACCAAGCTGCATTCGACTC
GGTGAAGAGAGCTTGGCGTCTGCGCCGATCCTGAAGCTCGCTGATGGATCAAAGGCACTTCACGTCGCCTGCGACGCGAGCGATTTTGCCATCGGCTGTG
CGCTGATGCAGTTCGATGATGACGAACATGAACGCGTTATTAGCTATCAGTCGCGTCAACGGAAGCCAGCCGAGAGGAATTTCCCAGTCCACGACAAGGA
GCTCCTGGCAATGCGGTACGCTCTGATCAAATTCAGAGTGTACTTGCTCGGTGAACAGTCGTTTGCGGTTTACACTGACCACGCATCGCTGCGGACAGCG
ATGAAGGGCCCTCGCTTGTCGCAACGGATGGCCCGTTGGCTGTCCTTCTTCTCCGAGTACAGCTTCGTTGCTCGCTACAAGCCGGGCAAGAATAACATTG
TCGCCGACGCGCTGTCTCGGCGTTCGGACTACGATCCCCGTGAAGCGCTAGGACATCAACTGGCTGATGAGGACGACGACGAATGTGTCGTCTGCGTGTC
GTCAGGCATCAACTTGACGTTGACCACGCCCACGCTCCCGCTGGGCGACGAGATTGCTACAGCGTACGATGATGACCCTATATACGGTGCCATCATGAAG
CACCTGCGTGCTCCTAGTAGTGACACGATAAGTGTCCTGTCAAGGACCACGCGGAATCAGATCGATCGATATCGACTGGACGGAAATCTGCTCAAGTACA
TGTACAGCATCGACAGGTTCGATGGACCTGGAGTCGTCGTCCCAAACGACGCTGATCTACGTGCGCGCATAATCCACGAGTATCATGACGCCCCGACTGG
AGGACATCTCGGTCGCGAGAAGACGTACGCGGCTCTGTCGCGAGAATTCTATTGGCCGCACATGTACAAGTGGATACGCAAGTGGGTCCGTACATGTGAA
ACTTGCCAGCGAGTCAAACCGTCTCCGACGTCTCAGGCACCATTGCGTCCTCTTCCGGTCGCCACGGAAGCTTAGCGCTCCATTTCGATGGACTTCATCT
TTGGTCTTCCGCCCGATACAACCGTGCGCACGGGTGAACTTGTGTTTGTCGATCGTTTCAGCAAGATGGTCCATCTCGTTCCGGCGGCAGCCTCAATCAC
CGCGGAATAGTCCGCGGCCCACTTCGTCGACGTGATTTTTTGTCACCACGGTCTGCCAGAGTCTATCGTGTCCGACCGCGACCCGCGGTTAACATCCGCA
TTCTGGTCACGCCTTTTCGAGCTCTTGGGAACCAAATTGCTGATGTCGACTGCGATACATCCGGAGACGGATGAACAAACAGAGCGCGTCAACCGAGTCC
TTGAAGACGTTCTCCGCAGCTATGCGACTTCGTACACGAGCTGGAGCTCGTTCCTACCGCTAGCCGAGCTCGCACTCAACAACGCCGAGCACTCCTCGAC
GGGTATGACGCCGTTCTTCGTGAACAACGCTCGCCACCCACGTGTTCCGGCACTTCTCGCCGTGGGCCACCCCACGGATGCTGGCGGCTCCACCCTTGGT
GGGGGAGAACCTCCTTCGGTCGACATGGATGCTGAAGCTGCGGTCAGCCCTGTGGCCAACGAGTCCGTGTCGGGGTCATCACCGGTACGTGAACCGGTGT
CTCAGCACGCACCGGTAGCCTCACCGGTGTCAACAGGCCTGCTGGCACACTCGACTTCAGGGTTATCTTCGGGTGTAGCCAGTGCGAACGCCCTGACTCG
CTCTCCGTCCAAGCAGTCCATCGAGCCTTCTCGGCATACTGCATCTCCGATAAGGAGATGGACGTCGCAGAACTTGATCGATCCAGGCAGCAAGATTCGT
GAGCAAGAAGTTACCACGGCCGACTATACTCCGAAAACCTCGGTGCTTCCTGCCGATCGCTCGGCGGTTGCGGAACTCGTCATGCAAAGGCAATCCATCG
CAAGGTTCGTCCGCGACGCACTGCAGAACGCAGTGGACAAGCAAAAGGATCAAGCTGATAAGCACGGTCGAAAGGCCGTGAATGTATTCAAGATAGGAGA
TCGCGTTCTCCTATCGACCGAGGGAATCCGCGCTTCCGCCGTAACCAACCTTGGCGCCAACAAACTTGCTCCACGCATCATCTCCTTTTCGAGTAGCCAA
GACCATGGGCGACGCCTACACCTTGGACATCCCGTCGTCACTTAGACTCCACCCGACTTTTTACGTCGGGCGACTCAAGCGGTACTTCCCTGCGACGATT
CCTGATTCGAGCCAGCAGACGGAGCATGCGTCGGGCGACGAGCCCGACGAGCCTGACGCGCCAGAAACCCGTCAGCCCCAGGCGTCCGCTCGCGCGGACG
ATCTCCTTGCTGGGCAGAGCCAAGCACATGCGTCTACAATCCCCGTAGGCGAGATAACAGCTTCCGATTCGACTGCCGAAGCTCCGACGCGATCTGCTCA
GCCCGCCAGGCACGATGATCCGCCCGCTCAGCCCCAACCTGAGCGTTCAACGCACGGTTCGAAGCTGCCTCCACCTCGCCCTGAACGTACAGGGCGTACG
CCGTATCATCGTGAAGACCCACTACCGATAATTAAAACGGTGGGTGATGCGCGCTGGATTGTGGAGCGTATCGTTGACCACGAAGATCCCCACAGCTCGA
CCGCTCAACGTAACGTATGTAGTCGTGTTCCTCGAGCGGTTCTGACCGCGCGCCGTTATTTTGTACGTTGGCTCGGTTATCCCTCAGAGCATGATACGTG
GGAGCCCCGCGCCAATCTTCTCCGCGACGTTCCGGACGTGGTCCACGAGTATGAGACCATGCTGCTTGAAAAGAAAAATTCCGCGGGTCACCCCGCCAAG
ACCGTGATCGAGAACGGCCACGAGAACAACCCGCACGAGGAGGCGACAGCGATGCCGCGCTCCGACGCGTGTAACGTCGGCGTGAGCCGCCGCGATTAGC
CGCCTGATACATACTGGACAGGGTGTACTCGTACTTCCCGATCTATTTCGACTCTTCTCCGCTGAGTGGGCGCTCAGCGAGATGTTCCCTTCATTCGCGT
TGCGTCAGACGGGTTGAAGTACCACAGGACTCACATCCCTCTCTCACGTGCACGAAGCAGATTCGATCCATATCCCACGCGTTGTTGCAGACCTTCACGC
GCAGATCTCCAATCGAATAATCCGCGAGGATCTCCTCGCGATACGCCAACCAGTCGACAAAGCTTTCTCCAGCACGCGACATTCGGTTCCATCGCCGGAT
GAAGGCACACCAGGAGCGACGAAGTCCCTCATGATCAGCGCCTTCGATGTATTGCTTCCGCGTCGCGCGGAAGAGACGAAAGTGGTTCTTCATAGTGTCG
AGCGTATCCGGATTCTTCGCTCCTGACAAGTCGTACAGGTCTCAGGGAACCAGAGCGTCGTCCATCACGCGCGACCGCGTGCTTCCGGCGCTGATCCTCG
TGACTGTCGGCTCAGCCGGTGTCTCGGCTGTCCGGGTTACCGCCGCCGTTAGTGTGTCGATGTTTGCTGCTGTCACCAGCGTCGCGCTGGTGCTAACGCC
CGTTGACTGCGTCGTGTTGTCCTCGGCCATCTTCGCTCCGTTGGGTCTTCGAGTTTTCTTCAAATGTGTTCCGTGCGCTTACGTTGCGTAAGCGCAACTT
AGAGAGGAGGGCGATGTAATGGGCCCAACTCCAATTACATAAGTAGGTAGATGTTTTCTTAGTTATTACATAAGTAGATAAAGTGGCACACGGGTAGCGT
GTGCCAAGGTGTCATCATCTGATTGGTTGATAGTGAGTAGCCAGACTCACTTATTGACCAATCAGGTATAGACATGTGTTTGAGTGGTTCACATGAGGCC
AGGGGTAGCCGCCCTGGTCCTAAATAAATCAGCGTTGAATTTGACACAAACCAAAGACTTAATTTTACTATTGCGAGCTTCCTCCACACTATAGTGTAAG
CTAGTGTAACGAGGCTAATAGAATCCTCTGCTCGCCGAGGTTTGGTCGACAGTACTGATAACGAAAGTCCAAAGTCCTACAGGCCGACGAGTACAATCCG
TGTACCCGCGCCGGTGTGCACCCGACTGGTGACAGCACCTACTTTATTTCCGTTTAGTCCTAAGCCTACAGCCACTGCCAGTAGAACGTTTCGGCAGACT
CTGCTGGCGTTGAACTCCGCCCGAATTGCACTCCGTGTCCGGGAACTACTAGTAGAACGTTTCAGTAGACACCGTCTGCTTTGCACTCGGTCGCTCCAAG
GTGACGCTCTCCAACGTCACAGGTTGTCCGACTTGAGTAGTAGACAGCCAAATCTCAAGTGCGCCAGCCTCTTCGCTCCCGTCCGTCCGTCCAATTCCTA
CAGAATCCTTGTCGACCCATCACTCTGGCAGCCAGCGCCAGCCTTCGTGAGAGACTTCAAGGTACTACTCACCTCCTCCTACTGCCTACCGTATCCGTCC
GTTTGTTTCCTTAAGTATCCGGCAGCTGCCTCCGTTGCACTTGCTACGGAAGCCAGCTGGTCGACCACTATTACACGAGTTCCTCGGCACTATTAATAGG
GTCTTCCACGACCCTATCGTCTCGGAGTAGGTGATCATACTCGACAGCAGACACCCACACGCGTTCGGCATCGTGTAACGTTCGTTTCATCCGCTCACTC
CGTACTCCATCGCTCACACTCATTCGACCGCCGTTACGCCTAACATTCACAACCGTCCGTTCAGCGTCCGTACCAACTTGTGCTCTCCATTCACCATCCG
TACCAGCTCTTGCTCTCCGTTCAACGTTCCACCCGTCTCGTACGTATCGCTCATCGTCCAAACCAACTCCTCCGTCGCAATCATCGTCCATTCCATCACG
TTCGACCCGTTTGTCGTACATTCCAACACCATCGATCCGTTCGTCGATCGCTCCAACCCGCCCGTCAACACTCGACGCGATACGTCCGTTACTCGCGTCG
TCCTGGCCACCACCGGTCTCACCAATTGCCACCACTCGTCCTTGCACGTCCGTCCATTCTCGTACAAAGTCCAAGGGTCGTAGCTCATATTGCAGCTCAT
ACTGTCCCACCTTGTTTCGGATTCGCCGCCTTCGCGTCTCCACCAGCCGCTCACCCGCGTCGATGGCTGACCTCGCTCGGTTAGTTGCCTCTCGGTGCCT
CTTCGGTGTTCGTCTAGCTTTAACGGCACTGCTAGCCACCGTCGCTGCAAGTACAGGCGCTCTTGCCGACGTGTCATCGCTGACTGCACTTTCGTCTTCA
TCTGCTAACTGGGCGTCCAAATCCGCCGCCGCTTTCTGTAGGAATGGGGCAGGCTCGTGGTAGCTCGCTAAGAAGGAGACGTGTGCTAGTAACGTCTCTG
GCGCGCCGACCTTATCCTCCCGTTGTAGCACAACGTTATCGTAGCCTGCCAGCTCCACAATCCTCATCGGTCCCATCCACTGGTGCACATACTTCGTCGC
GTTTAATCCCCGAGGGGGATTGTACAGCCACACTCGATCACCCACTACGAACGTACGTCTCTGTCTAACTTTTCTGTCGTAATAGCGCGCCTGACGCCTC
TGCTCCTTCAATCTCGCCGCCTCCGCGCACTCGTGTTTCATAGCCTCTACTAACTTCCGGTGATCCGGCATCAACCCTCCGGCTTCCGTTAATTCCATTT
GTCGTAATAGCTCGTTAGGCGCCCTGCGTTTCCTGCCCATCATGAGCTCGTTTGGCGTTAGCGCCACCGTCGAATGTCGTGCCGAATTGTACGCATAAAC
CGCGAACTTTACCCACAGATTCCAGTCGTTTTGGGCATCATTCGCCATGAAAGTTGCAACACAGTCCTTCCAGGAGCGGTGGAAGCGCTCCACCAAGCCG
ATCATCTGTGGTCGATAAGGGACTGGGTTGATTTGTTGCGCCTGCAACATCTCCGTCAATTGCTCAATCCCTTTACCCGCCAACTCCGGTGCACCGTCAG
TCAGCAATTCCCTAAACACACCGAACTTTAGCACTACGTCCTCCATCAGGAAGGACGCTACGCTCTCCGCCGAGTGCTGCGTTGTACACTTCGCCACAGC
GTAACGCGTCACATACTCCACCGCCGCTATGACATATCGGTCACCGCTATTTGCCACCGGGAACGGCCCAGCCACGTCTAACGCCCACCTGTCACCCACG
TCTCCAGCTCGTATTGATCTTAAGGGTGGAATTACTTCGCGTGGTCGAGCCTTGCGGCTTCCGCGCTCCTGACATCCTCTTACCCACTGGTTCACTTCGC
GTTGGAGGTTGGGCCACCAGTACAATTGAGAGCCCCGGCCGTATGTGTGCGGTCCTCGCAAGTGGCCAGCCCACACCGACCCATGCATGGTTTTGAAGAT
CACCGCTAATGAAGCAGGTGGCAAAACGATTCGTCTTCCTTGTCGCGTGTCTATCGTCACCAGCCCATACGTCTCCGTCACCTTCATGCCCTTATATACG
CCGTCCTTCAGCAGCTGCTGCACTAGCTTACTGCGTCGCTGAGCAGCTACCAATTCAGCGTCCGTTACTTGCAATGTCGCGCTACGTGGTGCGGCGTCTT
CACCCTCCGTCAACGGGGCCCGCAGTGTTCGAGCCCCCAATTCATCTTCGTGTCGCATCACCTCCGTAGGGCGTGTATTTTTCCTTTTCGTCGTCACCGA
TTTCCGCTTCCGTTTTGTACGTGCTGTCGCTTCATTCGAGTCTAACCGCAGGTCTCTCCCCGTATAGGGCCGTGTCGTTGCTGCGCCTTCCCTCGCCGTT
CCTATCACCGTTTGCGCCGGTATCACC