Description :
From Genome Similarity Track
Location :
Scaffold_403:16384- 18082
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_403-fgenesh-gene-0.3HECT ubiquitin ligase

Sequence
1698 bases(100 bases per row)
AGCTCGACGTACTCGCGCTTGTTGGCATCCGTGACGTCGATGTCGCCGCCCCCGAGTTTCAACTCGACGTCTCGTGGCCGCCCATTCGGCTGCGTCTCCG
TGACAGTGAAGTCCAGTCCCAGCATATCCACACCGTCGTTGTCCAGCAGCCAGCACAAGTTCTTGTAAGCGTCTGGGTCAAAGTACTGGAGGTCACCAAA
GCCCATGGGCAGCCCCAAGATAATCTTGAGCAACGGCAGCGCCAAGTGGAAGCCCGTGACATTCCCCTCCAATAGTGCGCGGCCCAGCACACGGCCTGCG
GCGAAAAAGTGCATCAAATGGTTCTCGCCCAAGATGGCTCGGGACTGCGGGTTAAGGTAGAAGGCCTGGTCGTGCTTGTCAACGCAGACAAAGATGCCGG
CGTCGGGCTGGATAATTGCTTCGTTCAGGAGCAGGAACCNNNNNNNNNNACAGACAAAGATGCCGGCGTCTGGCTGGATAATGGCTTCGTTCAGGAGCAG
GAACCNNNNNNNNNNGCCCTGCTCCCCGAGAAACTCGACGCGGACCCCCGCACGCGCCTGTGCGACGGTCATGGTCCCGAGCACACTCATGGAATCCGCC
AGCAGAGACGCACGATGGATGGCCAATCGCGTCGCTGGCGCGTTCGCGCCAGTGTCGTTGGCACTGAAAATGGACGCTGTCGACGTGATGAAATGAGCGA
CCTTAGCGGGAAAGTGCAGCTGCACACTGCGGATGCTGTCGGCGAGCATAGCGGCAGCCTCTGCGGACGGAGGCGCTCCATAGGCGATGTGCGCGGGATC
CGCGCCAGTCGAGTCAACGACGCGCACCGTGATCTCGTGCCACTCAGCTTCGAGGGCGCTTATGACTTGGTCTGGGGTGAGTACTGGTGGAGACGGCGGA
GTGTCACTGTCCACAGCCNNNNNNNNNNTAGTGCGAGTCTCGGCCTCGACCGGAGCAAGAACCGCCTCTTCAATGACGCGTCGCTCTGTCTGAAGCACAT
AGCTGGGCAGGCGAAGCGTGTCTAGCTGCGTGGCAGCACCCGCGTCTCGTCGCCACGTGGATCGTCCTCCCTCATCCACGACTCGCGTCCACTCACGTCG
ACGGCTGAGATAATAACACGCAAGACGGTACACAGTCCATCAGTCTGAGCGATTCAATCTCAGTGGTAGGGCTACACGGCGTACCGAATACGCTGTTGGC
GACTCGAGACCTGCGTCTGCCCTGCATTCACAGACGACCCCTTGGGCTTGCGCCGCACAGCGCAGCGCCACCACTTGCCNNNNNNNNNNGTGTCGATGGT
CACCACCTCTAGTGAGGTCTCACCAGCTAGTGGTGGAGCCGTCTGCTTAGGTGCGATGCGAGTCTCGACCTCGACCTGAGCAAGAACCGCCTCGTCGACG
ACGCGTCGCTCTGTCTGAAGCNNNNNNNNNNAAAAACCCCGCGCGGACCGCGCAGCTGCTCGCCGCCGCAGAGCACGCACATCTCGACGCGCACGGCGTT
TGTAAAGCCACAGGAAGCGCACTCCTGCGAGCCCATTTTGGCCTCGCGCACGGCGATCGCGACACGCCGATCGAACGCGTTCCGCGCCGTGCGCACGCTC
GGACTGTGGAGCGCGGCGTACGCGCCGTGGGCNNNNNNNNNNTTGTCGCGGCGGCCGCTGCACCAGGCGTACAGCACGAGCAGCGGCGGCACGAGCAA