Description :
From Genome Similarity Track
Location :
Scaffold_314:16382- 19255
Sequence
2873 bases(100 bases per row)
CGGGGGTGCAGCAATCTCGATCGGAGCGCCCATGACGTACGCTAAACGCTGACTGCTATTGTCCAAAAAGAAGACACTCGTCCAGGCGCTCGGGTTTGCA
GCTAGTGCAGTGCTGAGCTGTATCATGGGCGAATTGTTATCGCAGCGCAGCACACGTTTGAGCTTTTCATCGCTCAGCGAGATGCCTCAGCGGAACAGGC
GCGAGCGAGCAGCTACTTAATGTCTGTGTGTGCGTTTGCAGTTAGCGTCGTATTTGCGCGGGCTCTGGTTGCAACGTGTAAGTATTGAATGAGGTCCCAC
TCGGCTCGACACCACGCGGTAAGCAGGACCAAGTCGAACGATGTCTCAGTGACAGGGGCCAACGTGATGTTCTCTTTCGACACAAGCTGGAAGAAGCAAA
CGTGCACAACCTCGTGGTCTCCACGTCAGGTGCTGGAAAGTCATTTCTGAGCTCCTCTAGTGGGATGTACCACGTTGGACTCGCAAAGATCATGGGCTTC
GCGCTCCAGAACCTCCTAGATACGTAGTATATGGACGTTATTATCCAGCTCTCCAGTCCGTTCACTAATGGCGCTTTCGCTGCTGATATTGTCAGTTGGG
ATTGCACTTTCAATCAGCACGATTCAGGGAAAACACTGGAAGCTTTTCTTGGATCCACGATCTTGCTTCTCAACCTATCAGGTGCTGCTGATTACCAGCC
CCCAGCACCTAACCTGTTGCATCTTAGAAATACTGACCCCTTCATTGCGCCTTCTTCATGTTATGCAGAGAGCATGGCACTCGCGAGCTTCGTGGCAAAT
GTGTCTGGCATGAGGTGACGCGCGGTCTAGTGGTGCGCCGCCTCGTCTCTTTTGCTGCCGCTGGGCGGATCGCTCGCTTCGTGCATCGCTGTTATGACCG
CAAAATTGTATCCGCTCTGCGTCGGCGCTCTCTTCAGTACGGCAGGAGGCGTTCTAGTCGGCATGAGCCTCACGCAGGTGTTCCCACTCTGCTACACTCA
AGTTTCAAAGTAGTCGGCACGCGCTCCTGCGAGTGTCCTTGCCGATGTCGTGTTCCAAGCTACAGTTCACACGACTCTGGTGCTCACAGTAGGCTAGGAA
GCAAAGTAAGCTTCAGCTGTGAATTGCCTTGTCATTGCATAAAATAAAGCTGTCGTATCAGTGAGCTATTTCATTTCGTATCATCATTTCAACGCATTTG
GCTACATTTATTTGACCCTACCTGACAACCAACCATTTTTTGTTTCAATTCATGGTTATACAAACACTTTCGGGATGGCAAGGAGCACGACGCCAAGCAC
GACGCCTATCACCAGACCGTAAGATCTGTCGCTCGCGCAAGCGGACGCCGCCGGCAGAATCTGCGTCACTCCAATAGCAACTAGGGCTCCCGCAGCCATT
CCAATGAGGAAACAGCGCGAGAACGCGCTCATATCGACTCTCAGAAGAAGGATCCACGCGAGCAGCGAGCCCAGGAGCTTGCCAAGTGGAGCGAGAAGCG
ACCAGAGAAACCCTCGGAGCTGGCTGCCACTGGCAAAGTAGATCGAGGACGTGAACGCTTGCCCATCTACAAGGGCCACAAACAAGCAGAGTGGAACCTA
TGCGTCAGCCCTAGTAACAGCTCGCAAATTATGAACCCCTCACCATCAGCGTCAAGGTGATTTTACCTGGGATACTATGCAGCACAACCGCGAAAGCGAG
CACTTCGCCGAGTTGAAAGCGGCTCATCGCCGAGATATAGATGATCGCGCCAGCTGTCCAAGTGGAGCGACAAAGTATCAATCTCAGTCAGCACACCTTG
TCATCTTAAGGTCGTAAGCCATATCCTACCACATCATGACCACCACAAGTACCTGGCACGTGGTGCAGCACAATAGTGACGATGCTGATGATCCTCGCGC
GAACATGGTGCGGTTTTCGATCGGAATTTGCTGCCGTAGCATCCTGAATGAGCGTGCACTTTGCGCTCCTGATCAGCTGCGCGTTGCACGAACGCTCAGA
GGTCTGCAGCACCTCAAAGTCCGTGGTACCGGAGTTGCTCAGTCCAAACTGCACTTCGGCGCCATTCGAAATGTTTGAATCGCCACTAGTCACGATGCCC
AGACCAACGTGATGGAATGAATTGCTCGATGGAGGATCTCTGTTTCTTTGGGTGGAGTGGTTTTCATAGCAGGTCGAAACCGCTTTTGTGAGCTTGTGCA
CCACCATGTTCACGCCATAGAGCGTCACGACACCAGCGGCAAAGCTGGTTGTTGCAAGCAGGTGGCTGACGCCTCGCGTTGCCATCTGAGAGGCTGCATC
ATCGTCGTTCTGACTCAACACGAACTGCTCAAATCCGGACTGCGCAAGCGGCAGCAAGTCGGCAATCCCTCCGCCGATGAACACGAACGAGGACGCGGAG
AACGCCAGCACGAATACCAGCGACGCCAGGTTATCGCTGCGCCTGGACTCAGGCTGCCTAGCGGCGCTGGAGCACGAGACGAGCAAGCCGCCAAATACAA
ATGCCGCGCCTGTGCAGAGGGACAGCAGGATCGCTAGCAGCGCCACATCACCTCCTGTTGAGCTGCTGCTGGATGCGTTCTCGTCCGTCATGACGGCGAC
TTGACGGAGACTGACGAATGGACGGACGGACTGAACTCCTCTTTGTGAAGGAGGCACTCGACAGTTACTGCGTGGGCTAAGAACGAGCGAATTTTTGCGT
TCTCGGCGTCTGGTGATGGGAGGGAACGTTCTGGGAGGCGCATGACCCAGGCGGGGGTTTTGGTTTTGGTTTTGTTCCTGCTGTGGTGCTTCAAGGGCCT
GCTTCTACTGGATGGAGCCTCAACAATCCAATAATTGGTTGAATGGTGTGAGGGCTTTGAAGCCTTCCGTGAA