Description :
From Genome Similarity Track
Location :
Scaffold_632:1638- 6743
Transcript NameFunction/comments
Phyke_g10531conserved hypothetical protein

Sequence
5105 bases(100 bases per row)
CTGCGAGGAACCACAGAATGGAAAGCCGCGGATTTGAAGGCTCTGGTAGTGCTGGTGAAGCTACTCAGGTCCATCTATCAGTCAATGGTCCTAGAAACTA
TAACCATCATTCAGGCGTGGGAAACGCTCCGAGGATTCTGTGGCAAAGCGCTTTCCCAGATCGTGGTAAGAGATACCTTGATCTCggatcactcagctca
gacgTTCTGGGCTGGgtgagacgtgtgtgtactcacCTGCGATCCcttttcttggttcttcattaaggctacgctgtgggccCAGACGCGTGTCTtccac
accagctgcctccgatctcagagTCTCCGGAAACCCCAGACCTAGCTCAACCCTTCCCTGACAGATCTTGATCGGCGTGTGTCTTGCCCAAAATCCCCCG
GGTTTTATGTATACACACACTACCACTTATTccagtcctcttctttatagaccttggtcccaggtctctcagccttttttcttctcctAACGACTACAGC
TCAGAGTCGCGACAACCCCTTCTTTCCCGGTCGGCCTGGATCTGGGCCGAAATAACCTTATTACTAAGGACCTAGGTCAAGGTCCGTgccagcttctcct
ttcttctctaCGGGTCAAGAAACGACCCGGGAAAAGAATTTGGTGGCTCggtttgagccagtccgaatccaaagcactcTCACACACTCTGGGACTACCC
GCGCACGACGCCTAATTTAAGGCGGGCACTAGTAATCACTCAATACACTGGGAGATAACCAGTCACTCCCGACACACTATGCAATTACCTTGCCTAAACC
TCAGAGGAGATCACTTTCTCCCCGaaaatatgaaatacacacagctatcTGTCGTCAATAAAGGCAAGCTGTATGTATATGGGATATGAAATAACCAAGC
CACTTCCACTTAGTTAATTTGAGCTGAATTTATATGGGGTCCCTAACTTACTACCAATATTCACAAGGAATAAAAATCACCTGTGTCTTTCGGGTcaaat
tgaactctgattgtaaatcttacacatgcaaatataaaagacCTGCTAGGCAAAGACGCAAAGTCCGTCTGGGTACACCTTCACTTTGGGTGAGAAAGTC
CGCCAAGTTACTTGACTTCAGCGGCACTTCATAAAATGATGGCACTTGATTGGCTGAGACTTGTGAGGAGCTCATGTCAGCCGagccatgtcgaagttga
ggCACGGCTTGAAAGTCGTGATGTGCCGATCTTCGAAGTGGCTCTTGGAAAGAGCCACTTGTTGATCGCGGATTGTTTATCCGGGCCGGGTTGAGATGTT
ATCTCAACCCTGCCGCACATATCCCAGCTTTTCCAGCCTCTGCTCAGACTTCTCATCTGGGACCTTTATCCCAGATCTCGTCTCGGCCTTCTCAGCTTTT
GCTCAGCCTTCCCAGCCTTTAGCCCAGCTTTCTCAGCTTCGGGTCAGCTTCGGGTCAGCTTCGGGTCAGCTTTGGGTCAATATCTCAGACGTTGACCCTT
GCGACACGATGTTCGGGGTTGAACTTTGAGTGAGAACCGACTTCGGGCGGGCGTGTTGGTCAATCATGGATGGGGTTcgacttgggaggcgatctCAGTC
AGTCTACTGATGGGTTCAAGGTAAAACTTTCTGAGAACCTCAGCACATTTGTCTTTCAACTAAGTTGCTTTACACATAGACTTCGCAGCCTTCGTCTTAG
TAGACGCATGTGTACTGGTGGTGCTTCCCTTGCGGGTCATTGGCTTGAAGGGAAATATGTAAACCTGCCGCTTGCTTGGCAGTGTGTTGAACTCGTCTGA
GGTTGCCGTGCAGCCTCCAGTGGTTTGCCAATGCCCTTCAACCGTAAAGTCCAGTAAGCTATGGACTTTGGGACAAGGCGTGCCGCGTGTCTTAGTGTGG
GAGATATAAGGGGATACGCAACCCCTagttacatgaagagctgTCACACTTCCGGACTAATGTTGCTCACTAGTCTAGGTGGTCTATGTTAGGTCGGTCT
GTGTATACTACACAAAATGTGGACACCAGACATGGATTCTACGTCGATCATACCCCACTCACGCCTGTTTTGTGACGGGGCACACGTAGCACCTTGTGCT
AGAGGATGCTCGGATTATACAATTCTCCAGTGAACGATAGTTTACTACGTTCTCGGCCTGTAGGGCAAAATTTAGACGGGTGTATTTAATAGAATAAGGC
AGATTAGAAAGCAGCCTAATCTAACTAAATCACATACTGAAATGCATATAAATACCCCAGCCCTGGATTGGTTGGCTCCAGTAGGCTTGGTATCATGTTC
CACAAGGGTCGGTCGGGTGGAATGAAAAACCTGTTACGGGTAATATAGTACTTATATAGTAGTTTCTATTACTAATTGTATTAATACTTTAATATCACGT
AAATTTCAAATATATTACCATTATTCATATCATTTGAGAAGGTCGAGAGTATTATTACTAATACTACTACACCCTCCGACTACTATTAATCCCTGCCTCA
AGGAGATGCCAACAAGTGAAGAACCTTCCACTGGATTCATGCTTAGACTAACGATAGGCAAGATAGCTGCTATAACTTTAAATTTCAGTATTGATTTTGC
GGGCTTCGGCCCAAGCCACGCTTTCGGCAGCGGTCGGTCCACACGACCAATTCTCAATCACGTAATATCGCAACATATACGCGGTCCAATTCCGTGGGTT
TCGGATAGTGCTAGTGATGGTTTGGCGGAATTGGAGAAAGAGTTACACGCTACAAGCGAGTTGGGCATGTTACAGGAGTTGTAGACTACATTAGTTAGCA
GATTTGAAGTCAACTTCGAAATTCCCGGGTAGCGCTGCAGGCAATAATAACATGGCGGTCGACTGCtggacagcaccaacgaAGACAGACACAACTTTGT
CGATCAAATTGTGACCTTAGTCGCTACATGGGGACGCGCGCATAGCGTTCTTCATGAGCAGTCACGTCGATGGTGCCATGACTTCAGCATACCATGTATC
GATACTAGGAAAATCTACCATTCTTGACCGTAAAAAGAAATAGCACACTGAAAGAACCCACGGTCTTGAGTACATGGACAACAATCTATAGTGACGCATA
GCTCTACGCTTTCCAACAACACCTAATAATGTTTGCTAAACTGCGCAGACACAAGTTTGATAGCGCATGGATCAACCTCACGACTCTACGGATTTAATGT
CCCAACTTCCAAGGACTGCGCTCTTGATCGAAGTGCGCGCGGTTGACCGGGGCGAAGAAAGTGTCGCTATCCCACCAATACGGGAAGAGCTCGGCACCAG
GATGATTTGCACTTGCGTATGGGGAACCTGCCACTCCTAGTTCCAAGCAGTCGTTTAGCATTCGCATCTCAAGAATTTTCTCTGAGGAACGACTTTCTTG
GCGCTCTGACGGTAAAATGATATCatggagctcctccacgGTAAAGTTGAATGGCTGTTCTGGGGGTCCCGACGAACAGCTGGTGGAAGTCCCGTAGTTG
TCTTCACTAGATTTCATGAACCCCATCGGGTCTGTCGACCATCTTGGCATGCATTTGGCCGTACCAGAGTGTGCTGCATCCATCATGCTGCTCTCCGTCG
TTTGCAGATCACGACTGTAGCCACCGTTCTCGCGCTTAATGGTCTTAGCAGTACCGATTTCAGCCATGCCCGGGGCTCTCATAAGATCAGTGAAAGTTCT
CTTGCGTCTGGCCGTAAAGGCTTCAGCTGCCGGCCGCGCGCCAACTGTCGCAGGCCGACGACTGATAAACTCCGCGAGCTCCTGGGGGTGGCAGCGCACG
AGATGGTGATGGCTGAAAGTGCAGACGCTGGACTGGGTCTTGGTCCACTTTCGAAAACCAAAATTGTTTagttggcgctggaagctCGCAAACTTTCCgt
gcttgaagtacttggGCAGCACCACAACTTCCAGTCGCTTGGTGTCGAAGATTTGGAAGAATGTGCCGTCCTTGGACCACGTCAAGATCATTTGATCCTC
ATAGTGCAGGATGTCGTATAAACTCCGTAAGAACTTGGGTACTCGCATCGCACGAACGGTGCTCGCCTTCGTAGCAGATCCCATGTTGGCACTGCGCTCT
GCTAATTGTTGTAACGGGGGTGGGGCGCGCATACGGATTCTGTTCATGTTCCGATCGGAGGCTGCGAAGACTGTGCTGTGCTCAGACGAAATCCGATTGC
AAAATGAGGCATCGCTGCTTCTACCTTTGTACCGCCGTTGGCGTTCTTTCGGCCCGGTTGGCTCCAGGGGGTACTACCGGCGCTGCAGTTCAGGTCAGAT
CAGGCCTCTGCTGTACGATCGACACCGCATTCCTCCCAAACAAAGGTGCCCCCTCTGCCGGTCTGGGCCTTGGAGCCAGCTATGCCTGGACATTGCTGAA
CAGCAACGAGTTCAGACGAACTCATGCATGCTACTGCGCCCAGAAAGTTCGCGCCCGACATACGTTATTCGCCGCAACTCGGCCCAACCCGGGAGGTAGA
CTTCGTCTGTCCCAATGTGTGCCTACCCAAGTGTGACGGCGCTATTTTGCTCGATGCTGGATGGCGTGCAAAAATTCATGAAGTGACTACTGTTCCCATT
TACCTTCAACGTTggccaagcaacagcaattACTTACGTACAAGACGCACAAAACGAGCAGTGAAAGGAATTGCAGATCCTACAACACGAGGCTTTTGTC
AACTGGAATGGCCCGATAGATAACTGCTGAACTCAGATCTTTGTTGACGTCAAGTGGCAGCCAAACAGGTCCGCCACACAAACAGTGTCAGCGTTGTGTA
GCTCGTTTGATGCTCTTGCCACTTGCCATTGGAGCGCGGCGATGCTGATCCGGCGTACCGGCATCTCCTTCGTCCACGAGTCACCCCTTGAGTGAATGAC
AAGATATGCCGTCGAGAAACTCGTTGTGCTCGCCACTGCTGAGGCGCCTAATTACTTCTGCTGTAGTGCCAAGGTAAGTGCTCTAAATGTGCGTGAGCCA
TCTCTTGCAGGATGATTGGTAATGGCGAGGTGTGCTGTCTCCGGTCACACACGCTGGTATCCAAGCAGGGCTCCGCGCTGCTCAGTGCTAGTACCCCCCA
ACAAC