Description :
From Genome Similarity Track
Location :
Scaffold_881:1638- 6471
Transcript NameFunction/comments
g17782.t1hypothetical protein
g17783.t1hypothetical protein

Sequence
4833 bases(100 bases per row)
TGCTCAGTGTCAGTGGGTACTCCGCCCAAGACTTTGATCTCCCTCGGCTGAGCGAGTTCCCTCGCCTGGTGCTTGAGTCTGTTCTGCAAAACAATCTCAT
CCGACGAGAGCTAACGGGATATGACGCGTCTGTTCTTGAACAAATTGTGAGCGAGGAGGACCACCTAAATGAGGAGCAGCGCTTCACCTATGATCAGATC
ACCCAAGCTGTCGAGGACCCACAGGAAGGCAGGAAGCTATTCTTCGTTGATGGACCAGGCGGTACCGGGAAGTCGACACTGCTTCGGAACATACTGGCCA
AGGTTCGTCTATCCGGAAAAATTGCAATCGCGGTCGCTTCCAGTTGGATTGCTTCTCTGCTGCTTATGGGAGGTCGGACAGCGCATTCTACCTTCAAAAT
CCCCTTGAAGATAGACGGCGAATCTACTTGCAACATCAACAAGCGATCCCAGGTCACTGAATTGATGAGGAAAGCAAGTTTGATAGTTTGGGACGAGGCA
CCCATGGTGCATCGGCACGCGTTTGAGGCAGTGGACAGAACGCTTCGTGACGTTTTGGATAACGAGGCAGAACCTTTCGGTGGGAAAGTCGTTGTGCTTC
GGGAGATTTCAGGCAAATTCTCCCCGTGGTGAAGGGCGGCTCGGCTACAGAGACAATCGACGCATGCCTGAAGTCATCCGAACGGTGGCCACTTTTCCAT
AAGGTGCGTCTGACAGAGAACATGCGTGTTCGCACGGCTGCCACCTCTGATAGTGCTGCAGAAATGGCTGCGTTTTCCGAGTACCTGCTGAAGGTTGGAG
AGGGGAGACACGAGGTACACAATGATCTGGGAATGACTACATGAAGATTCCACGTGACATGCTCATCGACAACCCCGCCGGTGATCCAGATGAGGACGAG
GAGATCCGACCGGGAGCTACTCCGCGAGGTATGCGGCGCATGATCGACGAGATGTACGCCGACATCAACAATTCGGAAGTCGCAACGGACGAGTACTTTG
CGAGTCGCACCATCCTCACCACCACGAACGCGATAGTCCATCGTATCAACGAAGCCGTAGCGGATCGCATGACTGGACCAGAATATGTGTCCACAGACTC
AGTGGAGGATGACGAGGACGGGAACTTATTCGAGCAGGAGGTGCTCAACTCCCTGAACATCAGTGGCATCCCACCCCACAAGCTGAAACTCAAGAAGGGG
ATGCCGACCATCATGATGCGGAACTTAAATCCCGACCTGGGGTTGTGCAACGGAACACGCCTGCGAATCGTCGAACTCAAAGATCATGTCATCCACGCCA
CCATCATGGCCGGCGACAGGCAAGGCCATCATGTGTTGATCCCGCGCATCGTGTTCATCAGTGATGGCGACATCCGCGATTTCCCATTTCGACTGAGACG
CAGGCAGTTTCCTATCCAGACTGCCTTTGCCATGACGATCAACAAGGCGCAGGGACAAACGGTGCAGTACCTGGGACTGTACTTGGCGACTCCTTGCTTT
TCCCACGGTCAGCTGTATGTGGCCATGTCGAGGGTTACGTCGAGATCGAGATTCAAGGCGTTGATCGAGTATCCAGAGCGGGAGGAAGAAGACGGAGTGT
ACACGGCGAACATAGTGTACCGACAGCTGTTCGAGAGGGCGTAGGCAGCGACTTCGTGTGGATGCATATTTTACGAAATGAATACATTTGTCACTTTGCA
TAGCGGTAAATTGTTGAGAGTCACCATTCCCCCTCGAGCGCAGCGAGTACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGAC
CAAACAGTGCATGGTAGACAAGCGAAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTTTGATACAAGTCTACTGTAAAATATACTGAGATAAAACAT
AACACTGTCATAGTAAAAATAGTAGTGAAGCGAGCTGGATGAGCGAGCGAACGGGCACCAACTAACCATGCACCCACCGCCCGCAACGCGGGCGGCGCTC
GGCTAGTCTCCTACAAGTAACAGAGTAACCTGTCCGTCCGTCCGTCATTCCGTACGCACCCGGAGCGTAACGCAAATCCGGACTTTCCGTTGGCTATAAA
TAGCTGCCGAGCGCAGCGAAGGCGGCCTCCCCATTCGCTATTATTATAATGCGAGGCCTCTCATTGGCTATATAGTGGAACTTCTGCGCGATTGGCTATT
ATAATGCGTAGAGTGGACTACACCACATCGGAATTAGCGGACTAAAATCACTGATGCTGATTGGACAAAATAAAGCGCCTTTAACAACGTTTCTTTTCAC
GAGTTCCCACGCCTGGTGCTTCAGTCTATTCTGCAAACATCTCCTACAAGTAACAGAGTAACCTGTCCGTCCGTCCGTCCGTCCGTCCGTCTGTCCGTCA
TTCCGTACGCACCTCGAGCGTAACGCAAATCCGGACTTTCCGTTGGCTATAAATAGCTGCCGAGCGCAGCGAAGGCGGCCCTCCCATTCGCTATTATTAT
AATTCAAGCCCTCTCATTGGCTATTTAGTGGAGCCTCTGCGCGATTGGCTATTATGATGCGTAGAGTGGACTACATTACATCGGAACTAGCCGAATGAAA
TCGCTGCTGATTGGACAAAATAAACCGCCTTTCAACAACGTTTCTTTTCATTTCCATTTTCAAAACGACGCTCCGGCGACGGACCAGCTCGACGGAGGAC
CGGGCGGGATAGCTTCGCAGGCAGGTCATCCCCGCCGCAGGCAGGGTAGGTATAGATTAATCCTATTTAATTCTAATACATAACGATTTCGGGAGTGCCG
CCTGTTGCGGATAACTGGTACCTTCAGGGCAGTCGAGGGGTAACCGTGCGTGTTAGAGGAGGATAACCGGAGCCGTGCATTGTGTGGGAAGGGCACAACT
GCATGGAGGGATGGGTACCCTATGACGGCCACACTGATGCGGCCTAGCCAGCCCCCAAGAGGATCCCATCCCTGCCCAGCGAGCCAGGCCGACCTCTCTC
GAAGCAATCGTGACGGTTACCCCGTATTTTCGGGCTTTCTGGTGAACATGCTATTTTGGGGGGCTCCCTTCACCCCCGGGAAGCATAATTCCAGGTTAGA
GGTCCGATAAAAAGATTGCAGCTGGCGCCCGAAATGCGTTCCAAGACAGTCCGCCATCCAACCTGCTCTTCGGGGCCGCGGTGCTGAGGCGCCCATTTAT
GCCCGCCGGCATAGTGGGAAGTCTCATACCAATCCGGGGGACTGGGATGGGTACACACGGCGATAAAAGCCGGCCTAGCCGGGTCGTCCATCCTAGCCCC
GGGCTTGACACCGTGTAATGGGACCGGCCCATAGTGTGGTAACATGCTATTTGGGTTTCTGTGCAGTTACGGCTGTGGCGGACACTTTCCAATCAAAAGG
ACGAGTCGGCACTATTGTGACAAGTGAGGACCGCTCGACGGTGGCCATTTGCAGTGGTACCGGTGGAAAACCGTTGGTTTGGTGCAGTCTGCGCTCAAAC
TCGGGGTTTGTACGGCCCTTTAATGCCTATGATGCCTTGCTGCTAAAAAAAATATTAAAAAAGATTCCCAAAAAGCTGACACGTGTCCCTTTACAACCAA
AACGGTTAATTGCCTAAGCTGATAAAGCTCAGTGGCATTGAGCGCGACCGGTAGACCTCCGTTGCCAAAGGAAGCAACCAAAAGAAAAGAAAACAAACAA
ATTGAGGTACCGAGTCGCGCTTCAGCACCTCGAACCCGCAGCTGTGTCTCCAAAGGTATTGAGACGCAGCACCAATGCGGGGGGGCTTTAAAGGGATAAC
GGTGGATGTGAGGGACCAGAAACAAACAAAAGCAAACGCGGCAAGGCTAATGAGGTGTTTTACAGCCGTGCAGGACTCGGGTTCGTGGCGAGGACTGTGC
AAGACTGGCGGTGCTACACGGGTATTCTGCAGGTGTGTCTCCAGAAGGCGTCTCCTTGCGAATTGCGAGGTACCGACCGTCCTTTACTAACGACTGCAGT
TTTGGGTGGTTGTTTTCCAATGCACGTGCGCATTTATTGGGAAGTCCACTAACGCTGCATTTGCTGTTGCAGTTGTTGCGGACAGCACCATGGTGAATGT
CGGCAGCAAGCGGGAGCGGTACGGCTGTTTGTTGGTTGTTGTCAAGTGTCCCTTGCTCAGTGGTCTCTTTTGTTAGTGATGAGCGGCGTCAGGAGCTGGA
CCAGCGCCATACCCAGGCCCTCGATGCCAACGCGTCACCACAAGGATATGAGTCTCCGGCGTCTAAGAGGCGACGGTTGGGGCGCCGCCGCGCGGCTCAA
AGGCGGTTTCGGGTGGCAATGGAGCAGATGGAACAACTGAGCCTACAAGAGGCGGCCGCAGGTGGAGGGGGCGTCGTCACAGTGACAACGGGTGAAACCG
CCCCTCCTGTGCCGACGGTCGTTGGACAAGGGGCGACTAGCCAGCTCTCTGCAGGTGCTCCAGTGCAGAGGGCAACTGACCCACAAGCAAATCCACGTCG
GATGAGGGAAGCGCAGCGAGCGCGTTCCAGACGAAGTAACATGACCGACTCTCAGCGGGAGAGTGCGCGGCGGCGTGACGCGGAGCGAAAGCTAGCCCGG
CGAGCCCAGCTCCGTGCCGAGCAGCTTCAGGACGTACGAGAACGAAACCGGATCGCACAGCAGGAACGTCGGCATAATCTGAACGAAGAGGTCCACGCCG
CGGAGCGTGAACGCAACAGTGCTTCTCGCGCGCTTCACAGGAGTGTACACGATCGCACTGAAGAGCGCAGGACAGACCGGGAGCAACACGCGGACCGCCG
GGTTCAGTTTACGCAGGAGGAGCGTGCTGAAGC