Description :
From Genome Similarity Track
Location :
Scaffold_43:163797- 165933
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G012575Similar to CABIN1: Calcineurin-binding protein cabin-1 (Homo sapiens)

Sequence
2136 bases(100 bases per row)
ACGTAGTGCTGCAGTAAGCGCTTGTGCTTGTTCCTCTTGGCTCGACTCAAAAGTAGAGTGAAAGAAGTCATCCATACAGTAGACTCCTTGAGAAAGCACA
TACCTTGATGGATGAAAATAGCGATCTTCGTCTGGAATCGATTCCAAAGCGTCAACCACGTTTAGATACAGCCATCCGCGTGCAGAGTGAAGTGCAGTAT
CATCGCCTCTTTCTGCCCTGTCAAGGAGGCTAAATACGAGCTCCTTCGTCATCTTGAACGGCGCACCCTCTTCACCTTCTGCACCTTCATTTTTCCCCTT
TGTCTTCTTTTTCTTCTTCTCGTCGTCGCTCGAGTAGCTTCCAGTACCTTTATCATTTGTGGTATCTTCACCTTCGATATCCTCCTCGTCTTCCTCCGCT
TCCTCAAAATAATGCGTGCAGACTAAGCGCAAATCAGAAGCATTTACAGGGTGACTGAGCACCAATTCCATCCGCATGGCCTGCAGAGCATAGAAAGCAT
GGACCAGTGCATGCTCCATCTGTCCGTCTTCATGCGCCTTTTCTGCCTTCGCAAAGCAATCTATGATCGCTTCCGCTGTCGGAGCATCCATCGACTCTGT
GGCATTTGCTGTGACCTTCATCTGCTCGCAGCGTCGCATCTTCTTTAGTGTCTTTCCTGACATGAAATTGAGTCGAAAACGAACTTCTTCAGCATCTTCG
ACGTCCTCGCAGACCTTTAAACCATTCTGGAAATAAGTGAACGCTGCTTGTGCAACGCGAGCGTAGATTCCACTTGGAAAGAGTTGAATGTTTGCATGCT
TTACCACCGAGAACTCTTGTAAAACATTGTAAAGCAGCAACCCACACTCTTCGTTGCACTCGACAATAGTATTCCGCAGCTCATCAATCTCTTCGTGATC
CTCATCATCTTCTTCATCGTCTTCCGTTGGTTCATTCAAGTTCAACTTGTGCTCTTCGTTTCTTTCTTCAACAGCTTTCTCTAAAGTCTGATTTGCCAAG
TGCGCAGCCATTGCAAAGCATCGTCGTGCAAACTCAATCACCTGGACGATATAATAAATTGCAAACGCCTCCATTGAGAACGCGTCCAAGCCTTCTCCAG
TATTCTCATTTTTCAACTCGATTTGATCGTCTGCGATAGGAATACGGTACGCATCTTTGTCAGCTTGCTCTTTGTCGACCCACTGCTTCATTTTGTCAAA
CAAACTCATTCCGAGTACAATCTCCTTGAAAGTAAACTTCTTTGCGCTGTCGTCTCCCTTGGCAATGTTGTTTCCAAATTGCATTTTCGATGTATACTCC
AGAAGCGCTGCAATCTTTCGCTTTCTGCCCAGAATAACGGCACATGCGTCGGACGTGGCGTGGTAAAGCTCCTTCATCGTCTTTCCTAGACGAATCCACG
ACTTGACTCGTTGAGGGTGGTAATACAGCACATCTGTCATCAAAAACGAAATTCGCTCTTTCACTCGCAGCTCCATCTCCGCTAATTCATTCACATTTCC
ACGTCGGCGCACTCGTGAAAGGATGTAGTTTTCACCTAGTAAATACCACAAATGATCGAGCGGTGCTTGTTTTTCGAGCCCATTCGATTGTTCTCTCTCG
TCATCAAGTCCTGGAAATGGTCCATCCTCCCACTCCAATAGATTGGAAGGCGCGAGAAACTGCTGCAGCTCACTTGGACGATAGCGAGTCTGCACGCGCT
CTAACGAGTGGGTATCCTTCAAGGATTCGCGGATTGCGTTGAGCAACTTCAGGTTTTCTTTCTTTTGGCTGTTATTCTTCGGTGGTCTCGATAGGAGAAT
CGGGAATGCAAACTGAGCGAGGCGCAGTGCATTTGGCCGCTTGGTCGATGTGTCTCGTTGAAGCAGTGCAAATGAATTACCCGTCTTGTGATCCTCTCCG
CCAGGTAGGATGTGAACATCGTATAAACAGAGATAGCATTGCGCCATTTCCGTATCGAAACTACTGTCTTCGTCTTCGTCAACGCCAGCATCTTCGCCTT
CGGATTCGGCCTGCAGCTCACTGGATTTCCCATTAGCTGCATCAATACGGTCGCTAGCATGGGTGTACTTGCTCAGCACCCAGATGCAAGTCTCCAAAAA
GCAACATCGATCGCCATTTCCTCCACTTGCAGCACC