Description :
From Genome Similarity Track
Location :
Scaffold_148:16377- 19059
Sequence
2682 bases(100 bases per row)
GAGTACCAGCAACCAGATGAGCATTTTTGGTAACATTACGAAGGCACCTACTTGGTTCAACAAGCTTACCAGTAATCAGCTTATGAGGGCCCCCCCAGTA
ATAGTCGGTAAAGCTAAACGTGAAAATCGAGGTCCCACACCCTCTTTGATAAAAGTTGCTTCCAACTCTTGACGTCGAATATACCAATAGGCGTCGGAGC
CAGTAATATATGCAGAATGCAGTGAGCCTTTCATCAATCAATCCCAGCTGTTGTCGTATATCATTTGCCAAAAATCGTTAATTTGTGCGAGCAGCGTCTC
CGATATTTTTCTTTAGGTAAATGGTAAATTGTGATAACGTTCTTAAGTCCTGTCATTCATCTAGACTTTTAATCGATCATGCTTTGCAAAAGGGTAAAAC
AGAGATTTCGAGTCAGAGGGTCCAACTCGGCTAAAAGAAGAAGTTGAGCAATTTCATCAGTCTCGGATACGGTAAACTGACGATCACGTTATTTGGGGTC
TGCAAATCCATGAAGAAATAACTTTATATAAGTCATCACGGCTATTGAGGTTGTATCGAACTCGTGAATTGGATGAGACGCACCATCAGACCATGTGAAA
GCGTAATGCCAACGGTTAACTTCCAGGGGTTCATTACCGGTATCCTAAATGAGGAAGTGATAAGCCACTGCATCTTCTTCGTTAGTAGCGATGGGATTAT
ACCTTTACCAGCTTCCACGATCTCATCACCTTCAACAAATACTTTAGAGGGTTCTTGTGGTGCGTCCATTTTGGGTAGCAACCTGCAACTCTTCTGGATA
GAAGTAATATTTCTCCTAATTAATTTCTGGTTAATGATGTACCAGAAGTCTCCTAACCGCTTGTACACGTGCTCGATTGAACTTGAACTCACCAGAAGGG
CTGTCCTGGCCACTACATTTCACGATGATTATGGGATCTTGTCAGCTAGACGAGGCACTTCATCAATAAACACCGCAGTTTCTTGTCGGAAGCTGGCTAT
ATAACCACCATGGATAATATAACCATTCTTGTGCTTGAAATAAACATCACAGGGACAATGGGCGACAACAACATTGTCAGCTTTCTCAACAGGACCTTCA
CGTGATCAGGTATTAAAGAATCGTCAGTTATCATGTCATTTTCACATCCAAACTTTTTTTAAGAAATACCTGTAGCAAAACTAAGATACGTATGAGTAAA
GAATTTGCGAGTTATATATATTGCAGTGTAGACTACCTCTCTTGCAGAGGCTGAAAACATAATTCAGAGAAACGTAGATCACGTATGTAGTGGCCGTAAT
TTAATACAATAGAAAAAATTGACCTTGGTTGTACTTACGCATGTCTAAACAGAAAATCGCATTGCTTCACGACATCAAACTTGCTGATGAAAAGGGTCAT
TTCAAACGCATTAAACTAGTCAAGGTATTTTAACTTTTAATACAATATCGATAAAAGGTTTGGTTGCAGCGTTTCTGTGTAGTAATCTTCTTGCCCCCTG
ACTTGTAGTTTTTTCAGATCTCGCTGATCTTTCGACTCTATATAACGACGACCAGCACAAGCTTTAAAATTGAAGATGAGTAAGGTATTAGCATATGGTG
ATATAGCAGATACAATAGGTTTGATGATATGGACATTAAATAACATAAATGTATCTCGAATATCTTGAGCACGCCTAGCTTGAATTTCATCTTCTGCTCC
AAAATTGCGGCATGCGGTGGTTGCTAAATTGGGACTTCTAGAAAGGTTAAATAACCATTTGACACTTGTGCAAATACATCAATCATTAACATAACTTGAC
TATCTCGAGCATGTCGATTGTGGAAATCAGCTTATGTTTTAATCTGGAGGTGAGCGGCGGTTTCCGATTAGTATATTGATAAATATATTATGATATGGCA
CATGTGCACATACATCAAGCAATTACCAAATTTTACTGTTATGAGCATGTCTATCTTGGTATTTATCTTCTCGTACAATATAGAGGCAAGCGGCGGTTTC
CGATTAATATATTGAAAACATTGATAACGATTTGACACATGTGCTAATACATCAATCAATTACAAACCTTCATTGTTGCGAGCATGTTAAGCCTGGCTTT
CAGCTTCTACATCAATATGGCGGCAGGTGGCGGTTGCTGAATAAGTATATACAAATGGTTTAGCAAAGATTCTAAAAAGTGCAAGTTAATCAAGCAATTA
CAAACCTCGATTGTTCTGAGCATGTCTAGCTTTGTATTTAGATTCTGTATCTATTTGGCGGTGTGAGATGGTTACTTGATAATGTTGAAAATTAGGTATA
CCGATTAGGGAGAAAAAAGGGTTGCAGCAACGCATCATTTGCAAGCTCTTGTATTAATCACTATAAATCGAGATTATCGTGAGAAGGGAAAGCTTGCCTT
TGAGGTTTTGTTTCCGCTGTGCGCCTAGCTCTCATACCTGCAAATTTATCGATAAAATAGGGATGAAATAAGTTGTTGTTTATTTGAACATAATCTTAAA
CATCTATCAGAATAAACGATTTAATACACTTTTGACACGGTAATTTTACGATCATTTATTGATATAACCATGATTCATGACATTTCAATATGACTTTAAT
TTGACTAAACACAATTAATATGTATATAAATTTATGGCACGTATGGAGATGAAGACAGTAATTATCAGCTTCTTCCTGCTCT