Description :
From Genome Similarity Track
Location :
Scaffold_305:16371- 21217
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_305-fgenesh-gene-0.3PH domain containing protein
Pytiw_DAOMBR242034maker-piw_contig_305-fgenesh-gene-0.5Transmembrane protein

Sequence
4846 bases(100 bases per row)
GGCGACCGAACACGAGACCGTGCCGCTGACGCTTGCGGGCGTCAACCTGCTCATCGGCAGCCTCGTGCCGAGCACGTCGCTCGCGTCCTACGAGGACGCC
AAGAAGTCGCGCACGAGTTCGCGCACGAGTAGCAGCGGCAGCGGCAACAACGCCTCCTCGGCTTCGTCCAGTGACTTGGTGAAGCTGCAGCAGCCGCACT
ACGAGCGCGAGAGTCGCGCGCCGGGCCTGCACCACCACCACCACCACGAGGCGTCGTGGTCCCAGCTGCAGCTGAAAGACCGCATGGCGTGGGCACAGGG
CTTTCGCATGAACAAGAAAGGCGGGCTCGTCTTCCTCGACCAGGAGACGCTCAAGAAGCAGCAGGGCGTGTTCAAGGACGTGATGCTCCAGGTCGGCTCA
CAGCTGCTCGGCGGCACGCTCGCCGTGCGCATCTCGCTGCCGATCCGCATCTTTGAGCCGCGCACGCTACTCGAGCGCGTCACCGACGCGTGGAACTACG
CGCCGACGCTGCTCAAGAAGGCCGCGCTGAGCACGGGAGACCCGCTCGAGCGCATGAAGTTCGTGATCGCGTTCGTGGCCGGCGGCTTCCACTTCTGCAC
CGGGCAGCTCAAGCCTTTCAACCCGATCCTGGGCGAGACGTACGAGGCCACGTACGCCGATGGGACACACGTGGCCATCGAGCACGTGAACCACCACCCG
GTCAAGTCGGCGTTTACAGTCACGGGCCCCAAGGGGCTCTATCGGCTCTCGGGCGTCTACGAGTTCGAGTCGTCCACAAGCCGCAACGCGATCATCAACC
ACCAGCTCGGCAGCGCGAAGATCGTCTTCCAGGACGGCCACGCGATCTCGTACACGGTGCCGCAGATCAAGATGAGCGGCCTGCTCTTCGGCGAGCGCGT
AGTCGAGCTCACGGGCGCTTGCAAGTTTGTTGACGCGAAGCACCACCTCGTGGCCGACGTGAACTTTGGCGCTAACACGAGCTTCCTCTCCAAGTCGCAT
GGCGAGGACATCAAGGGCGCGATCTACCCAGCCAAGGTGAGTCTGCATTGTAATTGAATCTTCTTATAGTGAGCTCTTCGGAATCTGACTGTCTTGCTTG
TAGAAATCGGCCAAGCACGCGCTGTCGACGATCCAGGGCTCGTGGCTCTCGCACCTCCAGTTCGACAACAAGATGTGCGTGGTTTTACTTGTCCAGTGCT
TGAGGACATTTTCTGTCCACTTGTAGCTCTTCATTATCTGACTGGACGTCTTCTTGTGGTGGACACTTTTTGTCTGTAGCTACTGGCATGTCGAGTCCGA
GCCCGTGTTCGAGCACACGCCCGTGGCGGACCCGCTGCCGTCGGACTCGCGCTTCCGCGAAGATGTCATCGCGCTCAAGGTAACAAACCTTGAATTTGGT
TCGTGTGAGATATATTTTCTAATGCTAAGGATTAATGATATTTGAAACAGAATGGCGACTCAGTGCTCGCGCAGTCCGAGAAGCTCCGCCTGGAAGAGCT
CCAGCGCGCCGACAACAAGCTCCGAGGCGGCCACGCATAGAGAGGAAGCTGCCATGCGAAGATGTTGTAATTATTATTTTATAGTTTTTCTTTCATAGAT
CAAACACAAACATACGTGCAGCAGCCATCCTCAGTTTCAAATGCTTCGTTTCAATTCTGTTTAGAAAAATGAAAATGCAGGTGTCTGCAAAAATGGCGTC
ACCACTGTGCCGACCATCTCTCTCTTCTCGTCTCTCTGCTTGTTTCTGTGCGTTGGTTGGGTTTTCATCTAAGCGTGGGTAGCAGTGGTGCTGGGCTCGC
AGCGGTCGGTCTCTCTTTTTCTACTTGGTCTTCTTCTTGAGCTTCTCCTCGTCCTCCTCGGCGGCGTGCTGCTGCGCAAACTGCTCGACGCAGGAGACGG
CAAAGTACCCGATGAAGAGCACCATGACGAGCGAGCCGGCCTGCGAGATGAGACTGGACTTGGCGACCTCGCCCGAGGCGTGCTCGGCCGCGGCCTGGCC
GCTCGCCGAGTGGAACTTTTCGCGGCACTCGAGCAGAAAGTCGCTCACCTTGGCGTCCAGGCGCCAGGTCGCCGGCGTCACGTGCGCGATGAACGCCTCG
ACCTGCTTCATGTGCTTGTCCGTGAAGATCGTGATGAAGAACGCGGCCTGCAGGTTCACTTTGATGAGCGCCTTGCCGATGAGCGTCGCGCCGAAGAACG
TCCAGAAGGGCATGAGGAAGTGGCCGCAGCAGATGCCGCACAGGTCGAACGCGACGTTCGGCCACGCCGACATGAGCAGCACGCCCCAGAAGCCGTGCTT
CTCGAGGAACCGGATCATCCAGTCCTTCATGACGTTCATGAGGTTGTACTGCGACTTGGACTCGGCGATCTCTTCAAACTCCTCGTTGCGCTGGCCGGCG
AGACGCGCGGCGCGGCTGAGCGCGTACGGCGGGATCTCGCCCGCGGCCGTGCCGGCACCCCAGAGCATCGCCGGCCAGAAGACCTTCCAGAAGATCGCGA
TGAACGTCGCGCCATTCGCGAGCGGCTCGCCCTGGCACGACGCGTCGAACTCGCGGAACCACATGTGGTTACGCGAGTCAAAGTTCACGGACTTGCACTC
CTCGGCGCCCTGCACGACGAGGAAGATGTGTGGGAAGAGGAAGAGGATGCCCGAGTGCATGCCCGTGCCGAGCCCCACGGACGAGAGCACGCCGAGGCCG
ACCCACCAGACGACGAACTCGACGTTGCGGTTGAAGCCGTCCAGGAGCGCGTGGTGCTCGCCCTCGACGATCGAGGCCGCGGCCCAGAGCGCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGTCGCGT
TGTGCTGCACCACGTAGAGTGCGAGCCAGCGCACGAAGCGCGCAAATACGATGCCGAAGTGGTAGAGCGTGCTCAGCGGCCGGCGCAGCAGCGTGAGCTT
CTTGCGCTCCTGGCGGAGCTGCTCGGAAAGCGCATCGTTATGCGTGGGGGACGCGGGCTTTTGCGCCTGCTGCTTGCAGCTCCTCTGCGGAGAGGAGGCC
TTGGTCTTGGCCATCACTCTGTTGCTGGGTGACGTGTGAGGGAGTGCGGGCGGGCGTCGCTCGTCGATCGCAGTCTGAAGCTCAGGAGCCGATGACGTTC
TCTCTGTCCCGTGGGTTTCGCGATAAGAAAGGGGAAGAGAGCAACGTGGAGGAAAACTGGGGATGTGTCCTATTAATGCGAATGTGTCCTATTCATGCGG
GATTAGATGTCCTATTTATCCTATAATAAACAGTATGCGTCGATGTAGTAGAGTGCGCGCATTTTCTAAAAGGACAGAATGAGGTAGTACAAAACACGAC
CTGAATAGAAGGCTCCCCCCTCTGGGAGGTGATACTGACCTCATTATCGGATTGAACGAGTGTAGCCATGTCAAAACGCTATTTTGGGTAAAGCACTTGG
AATGGCATTGCCATCTCATTCGGAGGCCATGGAAGAGGCGGACGACGACCTGCTGGAGCGCGCGAGGCGCTTGTGTCTCGCGGCGCAGGCGATCTCCGCC
TCGCTGCCCGTGTTCTCGAGCCTGAGTGGCGGCAACCAGGACGAGGAGGTCCCTGCGAGTGCTGCCAAGAAGAGCCGTGGGGATGCAACGAACAAGGCTG
CTGCTGCTATTACTAGGAAGCACATACCTGATAAGCAGAGCAGCCTCAGTCTTCCTGTTGCGGTGACTCAGACTGCTCCGACAGTGCCAGCCGTGACGCG
GAAGCGGTCGCTCAAGAAACTGAAATCCGAGCTGAGCTCGACCAACCAGGAGACTCTTCCCGAACTCGCCATCTCCGATGAACAGCGGCGCCTGCGTGAG
GCTGAGAAGATCCGCCACGCCCAGGAGCGTGCACGTGCTCGCGTCTCCCGCACAAACCAGTCGGATCAGCTGGAGGCGGAGCGCGAGAATGAATCACGAC
GGCAGCAGCTGCTGCAGCTGGAGCAAGTCAGCGCCGAGAAAGCGAGGCTCGCTGAGGAGAGCAGACTGCGTGCAGAGGAGCGCATCCGCTCAAAACGGCA
GCTTCAGCTCGCACCCATCGACAGACAGCAGCAAATACCGATTTGTCCGGAGAAGTTGGCGTCCGATCTGGTCAAGATCGAGCGATTCCGACGCAAGACA
CTCACGAGATTGCACGCGTACGTGGGGGTTCTTTTTGCAACTCTGCTATGTGAAGCCCACGACTGTAGTCTCATCTGGTATCCGGTGTTTCTTGTGACTT
GTGACTTCTGACCGAGCTAGGCTGCCTTATACACCTGATAGTGTACCGACAACGAAGTCAGTCGACCAGAGCGACTTAGAGCACCGCTCTGCCACTGACA
TGGAGCCAGCTGAGCGAGATGAAGATCTCGAAGCTGAGCTGAGGAGACAAAAGGAGAAGAAGCTGAGACAAGATACACTGGAGCGAGTGCGGCGGCAACA
GGCGATCGAAGAAGATCAGCGGCGGTATGTAAAATGCTGCTGCCTAGCAACTCACGTCTGAGAAGATGAGCACTTGCTCACCTCATTGACTTGGCTACTT
TATGTCTTCGAGCAGGAAAGAACAGGATCATATTGAGCAGGGACTCTTGCGCTACAAGAACCGCCAGAAGGAGTTGGATCGCGTCGCGAAAGGCTTGGGA
CCGCCGAGGAAACCAGAATCTACCAGCAAACCACAAGTTGAGGTAC