Description :
From Genome Similarity Track
Location :
scaffold_236:1637- 3575
Transcript NameFunction/comments
Pl_107236hypothetical protein PHYSODRAFT_297155
Pl_107237ubiquitin-specific protease, putative
Pl_107238hypothetical protein PHYSODRAFT_297153

Sequence
1938 bases(100 bases per row)
TAAATGAGCAGGAAGCACTTCGAGCTGCAGCTGGGGTTGTTCCTGCGCGTAGACGTCGTCTTGTAGATCCAGCAACATTCGGAGACGCGTTAGTGGAGCT
CGAGACTTTCGGAAATGCCGTCCGCCATGCGTACTCTCAAGAGAGAGAACAAGTGCGTAAACTCGACTCACGCGAAAAGAGACAACTTGCTGGTGAACAT
CGTGAACTAGAAACACAGTTGAACGAGCTCCGCCAAAGTGGAGCTCGAATGCACGAATTCAGTAACCAGCTCGTCAGTAAAGCGCACATCGACGCGCTTT
TGGAATCAAGTAGCGGATCTCCATTGAACGAGCCAGGTGTTATCACACCACCTCGAAGTGCAGGGTCTACTCGTTCTTACACTCCACGCCCACCCCCTCG
TCGCGGTGTCAGCTTAAACTTATCAGCCTCGATACCGTCACAAGCACAGACTTAAGAACCTGCTCAAACGCCGATAACAACAGGGTAAACGCTGCAGTTT
AGATTAGGTTTAAATGGCCTGCTCAAGTTGTAAATGAACAAGCCAGCAAAAGTGTCGCTGAAGATAAACGTCAGCACATAAGACGCTATGCAGATTTCTC
TACAGTCGTTTGATGCTCTTCTTCTTGTTGCCTTTCTTTTTCTTGAGTGATGCTTCCGCATCGCTTCCAACCTTCTTCTTTTTCATTGGTGTCGATAGCG
ATACATCCTTTCCACCGTCCGAGCTCATAGCATCTTTAGCAGGTCGCTTGTGTCGATTATCGTTGTTATCACTCGCACATGTTTCCTTCTTCTCTTCCTC
TCCACTCGTCTCGCCAGGCTCCTCACCCGCCACTGCCGATCGCTTCGGCGCGTGGATAGTTGTCCACAGCTTCGCACGTCGTGCGTACTCGTCATAACTG
TCCAGGAAGAGCTTTCCGGCCTCATCATTCAACGATGACTCCGGGAATGGTACGATCAACAGACAGCGCACCACTTGTAGCACATGTGCGAGGCCAAGTG
TGGGTTTCCAATCCTTCTTGAGCGTGTTGACGCAGATGTCCCCTGCTGGTTGCGAGACATTCGGGTGAAAAATCTTGGTCAGGAAAATTCCACGCGGTGG
TTGCTCTGGAAAACTCTCAGTGAGTCTGAGTTTGACTGTGAAGTAGCCTCCTTCGTAGGGTGTATCCTCTGGTCCACGAATTTCAGCGTGAATCTCGCTG
AGCTGCTCCTCGTCCTGTGGAAGGTATCTGATGCCGTCCAAAGGCTGCAAAACCAGCTTCCGTATTTCGCGAGCCACACGTTGGGCCACTTGGGGCGGCA
GATTCTCTCGTGCTAGCTATATAGTAAGAAATCATAGACAAGTCTGTTAGTGTCATTTTTCAAAACAAATTGTAATTGTGAGACTTATAGAGCGAGGTGC
GGTATACAACTGGTATGCAATGAAAGACGAGAGTGTGGCAAAGATGGTGTATGTGCTTTTACCATTGAAAACAGTGTGTGTGTGATGATATGGACACGTG
AAGATCACGGTATGGAGACTTTCGCGGGGATTTATTCAAATGGCTCATTTTGGTCTGCCATTGAATTGTGATGTGGTGCACCCCAAATTATGAATATTTT
TGGAAGACCACACCGTTTAATTTGGAACATGAAGCGACGCAGTGGTTTCGACAGATGGCTACACTTCAACACAGTCGAATATGATGCAGTCCGAAGACAC
AGAGCAGCATAGGAGAAGTGCATCGAGTATTTTCAAGTTCCGTCGCCAGCCAGAGGATCGGGATGTTGTCCCCAAGTCGTCGGGTCGATCGAGCTCGTCT
ACACCGCGTAATCTTGTTGTGCCAGACTTGACTGACATTGGGGGAGCTCAATTACCTACTGCACCGCCAGAGGCTGCGCGACTATCGGGGTCGGCGAAGA
AGTATCTTCAGACTGACGATGGATCTAGTGGCCCGCCA