Description :
From Genome Similarity Track
Location :
contig_55:163698- 165169
Transcript NameFunction/comments
g11471.t1RAW35521.1 hypothetical protein PC110_g8184 [Phytophthora cactorum

Sequence
1471 bases(100 bases per row)
GCGCACGTTCCTCAAACCGTGCACAAGCAAGTGGATTCGACACCAAGACATGAAAACTGTCATTATCCGATTTTGTTCGCGGGGCTCACTGCTCACGTCA
ATCAAGCAAGATGCGTCTCTCCAACTTCGTAATCGTGGCTGCCGCTGTAGCTGGTCTTGTTGCCAGCGGGAATGCGCTCTCTCCGGCCGACTACAGCAAG
GTTTCGGAAATGGCGTCGCCCGATACGATCAAGGCTGTGCAACATTACGGAGGTAACTCCAAGAGGTCCCTGCGGGTTGTCGAAAGTGCCGATGAAAACG
CAGACGACGACAACGAAGAAGAAAGAATTAACTGGACCTCTGTAGCTAAACACTTTCCGGGAACAGCGGCCAAGAAGGCGGCAGACGCCAAGAAGGAGGA
AAGTATAATGGCAAAACTAGCCCCGGCATTCGCGGACTACAACCGTGCCGAATTGCAACCTCTTGACGTTTACCGTGCGATGAGAAAGGAGGGCTTTTCC
AAGACAAAGGCGATGGAGCATGGTAACCAGTACGAAGCATACCTGAGGAGTCTGGGACTTTATTAATCTTCGCCGCGCAGCACACACTCCATCAAAAGAA
AGTCGAAAACCGTAACAAGCTCAATAAGACAAAACTGCTTTATTAACGTTTTGAAATGATTGTCGCGCATTCTAATGTTGCTCGAATGTTTCCCCTCAGA
AGGTTACACTCAGTGTGGTCTACATACGCCATTACTCCATACAAATACCTAGTCACTTTGTATCCGCAGCCACAGGATCACCTACGGTATGGCCTCGGAC
GGTGCGCAACTGCAGGCGACGGTGCTGGCGGCGCTGTGCTCGCTCTATCAGCCGCACGTGGCGGACCCGGAACAGACGCGCGCGGCCGACGCCTACCTGC
GAGGCTTTCAGCTCACGCCCGCGGCCTTCGACGTGTGCGCGGCGCTGCTGGACCAATCGCTAGCGACTCGTGGCGCGCGACAGAATTCCGAATCGCTAAA
TTCGGACCGCGTCCCAGCTGTGTTCTTTTCGGCACAGACGCTGGCCAATAAGCTGCGGCGGCAGCCGTCCGCTTCAACTTCGGACGCCGGGATCTGGACG
CAGCGACTCGTAACCTGGTTATCCTGCGGCGTTAGAGTACCGAAAATAGTGGTGACCCAGTTACTGTTGGCGCTTGTATCAGCGTTGCCGCGTCTCCAGG
CGCAGGATCTCAAGGTTCAAGAGACTCATGACGCAGTTGCAAGTGGCAGCCAAGTGTACGCGCTGGTCCGGGAGAGTTACACCCAGTGCAACGGCCAGAG
CGTCGTGGGGTACGCTCTGCTGCAATTGGCTCAGAAAGGGGTACCCTCGAGGGTACTGGCCGAGTTACTGCTGCTACTGGTCGAGGAAGTGGACACTATG
ACAGACAAAAGTGCGAGACAGAGAATGCAGGACGAGGTGGATGCCTGGGCGCCCGCGGTGCTGGACAAATT