Description :
From Genome Similarity Track
Location :
Scaffold_41:16366- 17744
Transcript NameFunction/comments
Sapdi_VS20SDRG_11331hypothetical protein

Sequence
1378 bases(100 bases per row)
GTGCGACAGCGTCTTCCGGCCCGTCTCGTCCGCCGACGAGTGCTCGATAAAGGCCTCAAAGAGGCGCAGGCTCTCCTTCTTGGCCGACCGCAAGAGGCGG
ACTTCGGACGACTTGGTCGCCGTCTCGCCGCCCTGCTGCACCGCCATCGCAATGCGGTGCGTGTACGTGCGGTAGACGTTGAGGAGGTCCTGGAAGATCT
GGCCCATCTGCGAGTTGAAGCCGTTGGGCCCGATCGCCTTGCACACGTTGCCGTTCGTGCGGATAATCTTGACAATCTCCTTGACGACCGTGCTGTCAAA
GAGGATCTCGACGTTCTGCGCCGCCTGCTGCATGATGCTCGTCCACGCCTGGTTCGGGAGCTTCATGAGCTCGGCGAGGAGCGTGTCCTTGCGCGCGGGT
ACGTTCTCGGCGGCCAGCATCGACGCGACGGCCTCGTAAAACGTGTGCAGCTGGTGCGTCTGGAGGTCGCTCACCGTCTTGGGCAAGTCCATGAGGAGCT
CCTCCACAAACGGGTACGGCTCGGAGGGCTGAAGAACGACAAACTTGCGCCGGCACTTTTGCGAAATCTTGAGGAACGTGTCGCAAGCCATGTCCTGCAC
GCCCGGGTGCAGCTCGTGCATAAACTCAAAGAGCTTGTTGACGACCGTCTTGAGGAACTTCCAGTGCGCGCGGAGGAAGCGCGGGTACTGGCCGACCACG
TACATGATGTTCGAAGCGACCACCGCCTTGTTGTCCTTCCCGCGCTTCATCTCGCAGAGCCCGAGGAGGTCCTTAATGACCGTGACGAGGAAGCGCTTCT
CGTTCTCTTCGCTCATGGCGCCCGAGATGGACCCGATCGCCCAGCAGAGCGTGTTGAGGTTGTTCCACGACCAGCCGTTGCCCTCGACCTGGTCTGTGAG
TTTCTCGAGCATGATGTTCTCCGTGTCGTCATAGTCGAGGTGCGTGAGGTACACGAGGCCTTCGTGCATCGTCTTGTACTGCGAGAGCGCCTCCGTGTCC
TTGGTCGTCTCGCGCACAATCTCGCCATTCTCGTCTTCGACGATGAGCACCTCGGACGGCTTGACCATCTTGGAGATCATGACGACGCGGACGCGCGAGA
GGATCGGCGCCAAGAGGCCCTTGCGCGTGATCGGCTCGTCTTCGCGCTTGGACGAGAGCGAGAGCACCGAGCTGCTCTGGTGCGACTGCTGCTGCATCTG
GTTCTGGTCCACAGCGTACAGGTCGCGCGTAAAGAGGTGCCAGTAGTCGAGGCAGATCTTGAAGATGTTGTCGTCGTCAACCTCCGAGATGGACACGAGG
TACGAAAAGCCTACACACCGATGAGCTCTCCCTATTGAAGACTTGTGGATCGCTATACCCGTGAGAAGCGCGACGTGC