Description :
From Genome Similarity Track
Location :
Scaffold_7:1636413- 1641987
Sequence
5574 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTAGTAGTCCTTCCAACGACCAAGTCTACGATGAGCCAAGTCCAGATCTCCGGGGCAACCCTGGAGCATGCTGCATTCCC
CCATCTCACTCGCGTGGAGTGGGAAGCGCTTCACCGCCTCGTTGCGGTGTCCGGAGATGCCGTTGTCGCATCGCTGCTGAGCTCAGCGACGCCCGACCAG
CAACGTCTTGCAGCACAAGAGTTCATGGAACGCGAGCTCGCCGATGCGAATCGGCGGGTGTCAACTCCCTCGCGTCCATCCCAGAATGACGTCGTCAAGA
TGGAGACGTCTACGTATTCTGGCGCCGGTGAAAACCAGCTCCCGCTAAACCGGTGGTTCCGCGAGATCGACATCGCTATCGCCGCGCGACACATCGAGGC
GTCATCCGCCAAGATGAACTTCCTCCTCTCCCGGTTAGCCGGGAAGGCCAAAGAATGGGCCCTTGGGAAGCTGGTTGTCGACCCCGAGGCTTTCCCGAAT
CTGAAAACTCTCCAGAGCGACTTGCGCCTCGCGTTCAAGCCCCCGCAAGATGAGTCTCGCGTTCGTGCAGAGCTCTTCGCTCTTCGGCAAGGGCAGATGT
CCATGCGTGATTACGTCCAGAAGACGCGACATCTGGCGTCATGCATCGTGACCAATCCAATCGACATGGCCTCGCAAGTCCACGTATTTGTGTTCGGCAT
GCGCGAGGGTATGACCCGCTACTGCCTCACCAGAGCTGAGACCTCATCTCTCGAGGAGGCATTTGCACTCGCGATTCACGAGGATTACATCGTCGCCGCA
TCGTACGCCGCAGCCATACCTGCGGAAGCCCGAGAGTCTACCCCCGAGTCCATGGAGATCGACGCCATCAACGCGTCGAGCGATCGACGTCGCGGGTCCT
ACCGCGGTAACGCTGGGCGCAGCAATCGTTCGCTCATTTGCTTCCGCTGTGGGAAGAAAGGTCGCCGCGCGGCGAAGTGCCGCGCGCCAGCTCCCGTCGT
CGCTCACGTCGATGCGGAACACTCCTCGGTCGCTCATTCAAAAAACGACCAGGACCTGTAGGTGCGGGGCGCCCTACTGGCTTTAACGAAAGACCGGGCC
CTCCGGTGGCAGCCCAAGCTTCGAGCCCTCCCATGCTCCAAGCACACACCAATGACACCACTACGCCGGGCGACTCGAGACTGATCATCGTCAGCCTCCA
CGTCACCGGTGCCCGGCGACCACTGCGCGCGCTCCTTGACTCAGGACCGACCAACAACTTCTTTCGTGTGTCGTGTTTGTCGGTACTACCCAAGAACGTC
CGCGTCCGGAATGGTCCGGGCAAGATTCAAGTCAAACTCGCAGATGGTAAGGCTCGCCGCGTTGCGCGGCATGACGTGTCCTTGTCGTACACGCTCGACG
GCTTCCGAAGCAAGGACGACTTTCTGGTGATCGAGATGAGCTACGCGTTTGACCGCATCCTGGGCATCCCTTGGCTTGCACGATATCAGCCAGAGATTGA
CTGGCTGGCCCAATCAGTCAAGCGTCGACGTGGATTCGACGTGAGCGAGGTCTTCACGCACCTCTTGGTGGCGCCAAGAGACTGGCCCCACGTCACAGTC
GTGGACACAACAGCATCGACACAGGCAGTGCACAGAGCGAGCGATGACCCTCTCTGCATGGCTTGTGCTACGTTGTTGGACGAAAAGCCCTCGCGGTTGT
GCGAGGTAGATAATAAAGTGGTCGAGCAGAGGCTCCCACAGTACAAGACGGTGGTCGAGCAGGGGCTCCCACAGCATGAGAAGGTGGTCGAGCAGGGGCT
CCCACACTACGAGACAGTGGTCGAGCAGGGCTTCCCACACAACGAGACGCCGGTAGAGCAGAGGTTCCCGCCGAACATTTCGGCGGTCGAGCAGATTGGG
CTCCCGTCAAACGATGCCGCGGTTGAGCAGGGGGCTCCCGCATGTTCCCGGCCCGGTCGAGTACGGTCTCCCGCGCCTAGAGGAGGGTGATGCATCGTCG
AGTAGCAGTGAGTCAGACTCGAGCGTAAGCTCGAGGAAGTCGAAGAAGAAACTCGAAGAGACGACGCCTGAAACCTCGTCGAGACGCCACGATCAGCGAT
AGCCCGCCGATGGAATCGGTCAGCGCGCTGGAGTACGTGGAAGGAGGCCCGAATCGGTCGCGCACTATCGCAATAGCGAGTCCGCCGCGCGAAACGGCGG
CGATCACACGCCTTCCAGGCTTGTCCAGGAAGACCTTTCTTCGGGACCTCAAGGCTGGAGACGTCGAGCAAGTATGCTTGGTCACCGAGGCAGTCTCGGT
GGATGAGTCAGCAAATGCGGTCGCACCGGACAGCGTACGTTTACGTCCGCTAGGTGCTGAACCTAAGTCAGCTCGATGGGAACGATTCCAAGCGCAGTCC
TGAGAGGCCTTGCGGGAGTCAGCGAATCCCGTATACGACACCGCCTGCGAGTACGCCGACGTCTTCCCGGATGAGATTCCCGCGGAGCTACCGGCGGATC
GTGGGGTTCAGCATGAGATCGACCTCGCGCCTGGTACGAAGTACTGCGTCACCAGACGATGGTCACTTACTCGTGATCAAGTGAAAGCGATCGATGACTT
CTTCGAGGGCCGCCGAAAGGCGGGTCACGTGCGTGAGAGTACCTCTCCGCATTCCAGTCCAACGTTCTGTGTGAAGAAAGCAACAGGGGGATGGCGTATT
GTTCACGCATTCAACAAGTTGAATGATGCCACCATCCCCGCGCAGACTCCAATCTTTCGGAAGGACATGGTACTGGACTCAATGGCTGGCAGCGTCATTT
AGAGCGCCATCGACCTGACCGATGGATTCTATCAGATCCCGATGGCAGCATCTGATGTGCCTCTCACCGCCGTAAGTACGCCGAGCGGGATGCTCTGGGA
GTGGCTCGTGATGCCACAGGGTCTGAAGAATGCGCCTGCCACCTTCAATCGCATGGTCTCTCATGAGCTTCGGTCGCTCCGAAACTTCGCGCCGAGTTAC
TTCGACGACATCTTCATGCACAGCCGCGCTGAGGGGAACCTCAGTGCCGTCGAAGTACATCTGAAACACCTGAGGCAAGTCTTCCAGGTGATGCGAGAGA
ACGAGCTCTACGCAAACCTGAAGAAATGTGTCTTTTGCGCACCGGAGATCCCGGTGTTGGGATGCTACGTGAGCAAGAACGGTGTGCGCGCGGATCCCGA
GAGGGTATCGTCTATCTGTGCTTGGCCAACGCCGACAAGCCCCACTGAGTTGCGTCAGTGGCTTGGCATGGCCAGCTACTTGCACAAGTACACGAAGAAT
TACGCTGAGTTGATCCAGCCGCTGTCCTCGCTGCGGAAGAAGGACGTGATCTGGGAGTGGAAACCAGACCACCAAGCTGCATTCGACTCGGTGAAGAGAG
CTTGGCGTCTGCGCCGATCCTGAAGCTCGCTGATGGATCAAAGGCACTTCACGTCGCCTGCGACGCGAGCGATTTTGCCATCGGCTGTGCGCTGATGCAG
TTCGATGATGACGAACATGAACGCGTTATTAGCTATCAGTCGCGTCAACGGAAGCCAGCCGAGAGGAATTTCCCAGTCCACGACAAGGAGCTCCTGGCAA
TGCGGTACGCTCTGATCAAATTCAGAGTGTACTTGCTCGGTGAACAGTCGTTTGCGGTTTACACTGACCACGCATCGCTGCGGACAGCGATGAAGGGCCC
TCGCTTGTCGCAACGGATGGCCCGTTGGCTGTCCTTCTTCTCCGAGTACAGCTTCGTTGCTCGCTACAAGCCGGGCAAGAATAACATTGTCGCCGACGCG
CTGTCTCGGCGTTCGGACTACGATCCCCGTGAAGCGCTAGGACATCAACTGGCTGATGAGGACGACGACGAATGTGTCGTCTGCGTGTCGTCAGGCATCA
ACTTGACGTTGACCACGCCCACGCTCCCGCTGGGCGACGAGATTGCTACAGCGTACGATGATGACCCTATATACGGTGCCATCATGAAGCACCTGCGTGC
TCCTAGTAGTGACACGATAAGTGTCCTGTCAAGGACCACGCGGAATCAGATCGATCGATATCGACTGGACGGAAATCTGCTCAAGTACATGTACAGCATC
GACAGGTTCGATGGACCTGGAGTCGTCGTCCCAAACGACGCTGATCTACGTGCGCGCATAATCCACGAGTATCATGACGCCCCGACTGGAGGACATCTCG
GTCGCGAGAAGACGTACGCGGCTCTGTCGCGAGAATTCTATTGGCCGCACATGTACAAGTGGATACGCAAGTGGGTCCGTACATGTGAAACTTGCCAGCG
AGTCAAACCGTCTCCGACGTCTCAGGCACCATTGCGTCCTCTTCCGGTCGCCACGGAAGCTTAGCGCTCCATTTCGATGGACTTCATCTTTGGTCTTCCG
CCCGATACAACCGTGCGCACGGGTGAACTTGTGTTTGTCGATCGTTTCAGCAAGATGGTCCATCTCGTTCCGGCGGCAGCCTCAATCACCGCGGAATAGT
CCGCGGCCCACTTCGTCGACGTGATTTTTTGTCACCACGGTCTGCCAGAGTCTATCGTGTCCGACCGCGACCCGCGGTTAACATCCGCATTCTGGTCACG
CCTTTTCGAGCTCTTGGGAACCAAATTGCTGATGTCGACTGCGATACATCCGGAGACGGATGAACAAACAGAGCGCGTCAACCGAGTCCTTGAAGACGTT
CTCCGCAGCTATGCGACTTCGTACACGAGCTGGAGCTCGTTCCTACCGCTAGCCGAGCTCGCACTCAACAACGCCGAGCACTCCTCGACGGGTATGACGC
CGTTCTTCGTGAACAACGCTCGCCACCCACGTGTTCCGGCACTTCTCGCCGTGGGCCACCCCACGGATGCTGGCGGCTCCACCCTTGGTGGGGGAGAACC
TCCTTCGGTCGACATGGATGCTGAAGCTGCGGTCAGCCCTGTGGCCAACGAGTCCGTGTCGGGGTCATCACCGGTACGTGAACCGGTGTCTCAGCACGCA
CCGGTAGCCTCACCGGTGTCAACAGGCCTGCTGGCACACTCGACTTCAGGGTTATCTTCGGGTGTAGCCAGTGCGAACGCCCTGACTCGCTCTCCGTCCA
AGCAGTCCATCGAGCCTTCTCGGCATACTGCATCTCCGATAAGGAGATGGACGTCGCAGAACTTGATCGATCCAGGCAGCAAGATTCGTGAGCAAGAAGT
TACCACGGCCGACTATACTCCGAAAACCTCGGTGCTTCCTGCCGATCGCTCGGCGGTTGCGGAACTCGTCATGCAAAGGCAATCCATCGCAAGGTTCGTC
CGCGACGCACTGCAGAACGCAGTGGACAAGCAAAAGGATCAAGCTGATAAGCACGGTCGAAAGGCCGTGAATGTATTCAAGATAGGAGATCGCGTTCTCC
TATCGACCGAGGGAATCCGCGCTTCCGCCGTAACCAACCTTGGCGCCAACAAACTTGCTCCACGCATCATCTCCTTTTCGAGTAGCCAAGACCATGGGCG
ACGCCTACACCTTGGACATCCCGTCGTCACTTAGACTCCACCCGACTTTTTACGTCGGGCGACTCAAGCGGTAC