Description :
From Genome Similarity Track
Location :
Scaffold_1:163616- 165389
Sequence
1773 bases(100 bases per row)
CTCTAGCCAACAGCGCAGTTAGGTTAAAGGGGGAGAGCGAGCGAACGGAGAAGTTCTGCTGATACCGCAAGACTGTAGCGCTAAGTGTGTTTTGCGGTAT
CACGAACTGTGTGAGTTGTATGGTTATCTATGTGTCTCAATGCGGGTTAGGGTTACCAGCCGGATGAGGGGAGCAGGTGAAAGCGATTTCCAGGATTTCA
TAAAATCGCCCCTACCGAACCTGGCGCTCCCTTAACTATAGGCAAGCCTGGGCTCATCGGAGAGCTAGCCTTGGCTTTTGGGCCCCATCACCTCCGGCAT
GAGCTCTGTAGCCATGTCGATGATGAAATCAACCGTTACGGTGTGCTCCAGCCGTCGCTCATCCTTGATAAACACGCACAATGTGTCCTCGATCGGGGCC
GAGTCGGGCTTGCGGCCGCTGCCGCTGAGCGTGAGGCACGGGAGGGAACCGGAGGGAGGTAGGGGCTGGCTCGAGGCTGACGCCGGGACTCTTGGGCCAG
GCGGGAGTACTTGCGCTCCCAGTTCTGCAGCGAAGGGTGGGGGAAGCCACTTGACTCGGCAAACGCACTGCGACTCGTGCCGCTAGCGCGTGCAGCACGC
CAGTCTTCAACGGCGCGCGCTTTGAAGCGGTTGGTGTAGTGGGTAGGGATGCGGTCGCGGGGCATGCTGCTACTGGTTTGGAAGTCGGGCTTCTGCTGCT
GCTGGAGGTTTGCGCTGTGTGCTTGCCGTCTCGAAGAAGCCGAACAGTTCACGGCGCACGTCGATCAGTCATTTTCTACCGTGTTTTATAAAATGATGTA
AATGCTACCGTGTTTTATAGCAATTTTCGCCTTGTCGCAGTACTACCACAATTATCGGAATGATAGAGCACAGCGCAACCCGTTATAGAAAATTGGGGCT
CTATCAATACGACTTTTTCGGTATTTCATGGAAGTGTTGCATCAAGGCTGGTTCTGTACTAAGGAAGATCTACTTTTCTTGGTCAAATTCTTTATGAGCT
CGCAAAGGAGCGTCTCGCTCGTAGTAAGAACCCCAGGATCATTGCATTGGTTCGTCTGAAAGAATTGACGCCGTTCCGATTTATGACTGACAAGCTGGCC
AAGTCGAGATGCCAACAAGTTTTGTCTAGGCTTAGGTAGGGCCGCTAAATCAGGGTGCTTGGATGTACTGGTATGCTCAAGGTCACATCGATAAGCTTTT
GGATAAGAAGCAGCCCCTCGAGTACATTAGCCGTGGGGGTTTAACCGCTTTCGCTATCCGTTTGCCCTGCACTTGCAGCAGCAGCAGCTTAAAAGGGTTT
TGAACGCAGTGTCTGGGCCGCACAAGTAAGTTCTAGGCCGTACAAGACGCTGCAAAAGCGCAAGTAGGCGTTCAATGCTCGTCACGAAAAAAAAAAACAG
TCGTTCAGTTCATCTTCTTTAGCAGTTTACATATAGATCTTTGTCTAAGACATTAATGCTGATGGAGTACATGTAGCGAGATCGGTTGACGGCCACAGTG
CATTGCCTTTTCCAGGTACATCGTATCGTTGTGAAGCAAAACCAATAGAGCTCGAGCTCCAAAGCAGAGTTCGGGCGAACATTTTTAAAAACTAAATGTT
TGAGTATATTTATAAAAAATAGATGTCCGGTCTTTTATTTGGTACAGGACTTCTATTTTCAGTAACTCCAACCTATTCCTGACCGGACTTCTATTTCCTA
CAGGTCTTGTATTCGGGAAAAACCGTTACGTGCAAGTTTTGCAAACGCAAAACCAATCCACTGCTTCGCCAAC