Description :
From Genome Similarity Track
Location :
scaffold_90:16360- 18138
Sequence
1778 bases(100 bases per row)
TCTTGCGTTTTGGCAGCGAGAAATGGTCATGGCCCTCGTCAACTCTTGCTATGTGGCAAAATAGCCAGGCCGTTTGACCTCCTTTGTCATCGCCAAATCC
CTCGCATGGGTTCAGTGCAACATGGCAAAGGCCACTTGACTACGGTCATCATGAATTTGAGCCATTGCGACGGTCGAAGGTTTTGCCATGCCGTCAACTC
AACAGTGCATTGTACGACTATATACAGAAGCTCTGTTAGCTTCGTGCCCCAAAAATTCACGTGATCAATCGGTCAATccgatggaagcagtgaTTGCTAC
TACTGAAAAATCAGAACCAATTGATTTCGGCGCGATGACTATCCGTAGGCAGCAAAATCGTCGTTATGGATGTCAACAATGTAGTCACTCCCGTCGTAGT
TGTTCCGAGCCATATGGTACCGATATCACGAGGCATTCGGGAAACACCGGTACCCAGTAGACGCAAGGCGGTCTACTGGATTTACGAGAATGAGATGACG
GTTCTTGCTCCCCCTCAAGACGGAAGAATGCTGTCGACATGTGTGTACTGGAGAGTCGAAGCAATAGACTGTTGTATAGCCAATACCCCGACTGATACAG
TAATTGAGTAGGATTTTGTATAAATGACCAAAAAGATGATGCACCCACCTGTTTTGTGGTTGAGCACACATATGTAGAGGAATCAACAGAATTTTTGATC
GGAATGCGATTGTCCGTGGGTGGGTTAGTCCAGCGTATGATGAAAATGTAGCGTGCGAATATGCTGACTCACGTATCCTGGATGCACCGACTAGTTGTGA
AGTAACCAGAACAGATATTATTTTGGCACCGTTATCAACGATGGAAGATCTGGTGCAGCTTGAGAAAGTCATTTACGATGGATTCCTACCTGACCTCAAG
TGAAATTTTGATGAGTTTCactctgctgtcttttttCGTGAATAGATGTTACAGAAGCTGAAAACAAAGTGATTTCTCTCTAACCAACGTGTGGGCAAAG
CAGGGCAATAAAAATACCTTTGTGCAAAGAAGAGCTAGGAATGAATCATGAGTTTTTTTCGagatagccatcttgctttAGTCGAAGATCGATTCAGCGG
AACTACGCTcatatcagttttggatgatTCGGCTCTCGAATAATTTTGAAAGCGTGTGGACCACGCAGAGAATCTGCTATTTCGAACGGTTTAACTGATT
CTTATCATTCACTTTGTTTTGGAATACAAGGATGACGTCCTTAGTGCAAACTCGCCCTCTGACATTCGACCCGAACGGGAAATCGACACGAAATTGATCG
TGAACCTGGTTCAAAGCATGTTTTGCTTTGCCAAAGTCCACTGTCGCTTGGGCTAAGTAAGTATATCGATAAGCTTTTTAACTAAGAGCAAGCAGCTGGT
TTGGTTAGGGAGAGTAAGTCCCCTGACTGCACGccgacgttttgtgtgcgtGCACCCAGCGAGAAATGGCGTAACGCTCACGTCTAAAACAAGACAATTG
CGCTGGCGATTCCCTCTCAAACACCGATTCCGCGTAAAGATGTCATCATATACCGTATGTTCGACTGTACACAGTTTAGTGTACTTGATATAGTTGATCG
ATATCACCAGTGAGGAGGACATCTCTTTGACGGCTGTTAGTGCACCATCCGGCATATCCCGGGAGTGGCTTGTCTATCCAATGCCCCGGTAGCGTTCAGT
CGATAGGATTTCCATCTGTTTCAGCCACTGCGAAGCTTTATGCAGACATATTTTGCAATATTTTTGTCATTCGAAGGG