Description :
From Genome Similarity Track
Location :
scaffold_136:16359- 18583
Transcript NameFunction/comments
g4364.t1 myosin-like protein

Sequence
2224 bases(100 bases per row)
CTATCTGCACGAGCCTGCCATCCTGTTCAACCTCAAGCACCGCTTCCTCCGGCAAATCCCTTACACATACACTGGCGCCATTTGTATCGCCGTCAACCCA
GTACGTGGCCTCATGTGTCCCACTATAAGTGTACCTCAACCTGAGTTATTAACTTTTAACTGTTATTGCAGTACTCATGGCTCGATATCTACACTAAGGA
GCTCCAGGAGCAATATCTGGAGCGCGACCGTAGTGAACTGCCTCCTCACGTGTACGCTACGAGTGCTGGCGCCTTCCAGCACATGCGCGTGTTCGGAGAG
GACCAGAGTATCCTCGTTAGTGGTGAATCCGGAGCCGGTAAGACGGAAACGACCAAGATTTTGATGTCCCACTTAGCGTCGGCCGGCAGCCACTCCAATG
CAGACGCCCAGGCGAAGGAGGCCAGCATCATCGAACGTGTATTGGACGCTAACCCGCTGATGGAGTCCTTCGGTAACGCCAAGACCTCGCGAAACGACAA
TTCCAGTCGATTCGGTAAATTCTCCGAGCTGCAGTTCGATGCATTGGGCCAATTGGTTGGTGCTCGCTCCCGTACGTATCTGCTGGAGAAGAGTCGTGTG
TCGCTCCAGGGTCTGGGAGAGCGTAACTACCACATTTTCTACCAGCTTCTGGCTGCCCCCGAGGATGTGACCGCGGAGGTGAAGGTCACGGGCATGCAGG
CTAAGGACTTCCCGTTCATCAAGCCTCATGATGAAGATTTGGGCAATGGCATTGACGTCAGCGCTGGACTCAAGGATGCCGAGCGCTTTCAGCAGACGGT
GTCGTGTTTGGAGACGATGAGTGTATCGAAGGAGGACCAGATGAGTATCTTTAAGGTCGTGGCTGCTATCCTGCATCTGTCGCGTCTGCAGTTTGAGCCG
ATGCCAGGCAACGATGATGCCTCGCAACTTACGGGCACCCCAGAAAATCAGCACGCGAGTGAGCTCGTGTCGCAGCTGCTGGAGTTCGACGACAACCAGT
TGCACACGGCGCTTTGCACGCGTGAGATGACGGCTGTCATGGAAACGTACGAGGTGCCGTTGAACGTATCGCAAGCGGAGGGAGCGCGTACAGCTCTGGG
CGTTGCGTTGTACTCGCACATGTTCTCGTGGCTTATTCACCGTGTGAACATGTCGACGAGCGCTCCGCACGCTGATGTGGCTCACAAGATTTGCATCCTG
GATATCTTCGGTTTTGAAATCTTCGAGAAAAACTCGTTCGAGCAGCTGTGCATCAACTACGCCAATGAAAAGCTGCAGCAGAAGTTCACCCAGGACGTGT
TCAAGTCCATTCAGCAAGAGTATGAAGACGAAGGCATCCCCTGGACGCGCATTGAGTTCGCTGATAACGTCAACGTCCTGTCCCTGCTCGAGGGCCGTTT
CGGTGTGTTGTCACTGCTTAACGAAGAGTGCATGCGCCCGAAGGGTAGCGATGCTGCATTTGCCAACAAACTAAAGGCGCACTACAGCGACAACGACCGC
TTCGAGTGCCCGCGTTTCGCCCGCGACGCCTTCGTGATCAAGCACTACGCCGGACCGGTGCAGTACGACACGAATGGCTTCTTGATCAAGAACACGGATG
CGTTGCAAAACGACCTGATCCTGTTGATCAAGAAGTCAAAGGCGCCGTTCCTTAAGAAGCTGTTCCCCGAAGAGCACGTGGGTGATGCCATGACGGGTAT
CCCGGGCACGAGTGCTGCGGCTGCGGCTAACGCGTCGCGCGGACGTCCCGGTCTCAAGCGCAAGAACTCGATTGTTGCCGATACCGTGGGGACGCAGTTC
AAGAGCCAGCTGAACGGACTCATGGAGGACATTCGCCGCACGAACGTGCACTACATTCGTTGCATCAAGCCCAACGGCAAGAAGAGCCCGCTTATCTTCA
ACAAGCCGCGTGTGACGGAGCAGCTTCAGTGCGCTGGTGTGGTGGAGGCCGTGCGCATCAGCCGTATGGCGTACCCCAACCGTGTGCTGCAGACGATGTT
CCTGGAGCGTTTCCGTGGCGTTGCCTCGGCCACGACCGTCGACGGCAAGCCTTCTGCGCTTGCTGTGCTTGCTGCTACTGCGGATGAGAACCCGGCCGAT
GAGGAGAAGACTGTCGCTGCTGTGCGAGAGCTCCTGGAGAGTCTGATGCCGGGCAAGGAGAGCGAGTACCAGATCGGTAAGACACGAGTATTCTTCCGCC
AGGGCGCCCTTGAAGCGCTTGAGG