Description :
From Genome Similarity Track
Location :
Scaffold_61:16357- 40902
Transcript NameFunction/comments
g13883.t1RAW43616.1 tRNA wybutosine-synthesizing protein 2/3/4 [Phytophthora cactorum
g13884.t1hypothetical protein
g13885.t1XP_009515939.1 hypothetical protein PHYSODRAFT_474162 [Phytophthora sojae
g13886.t1XP_009515938.1 hypothetical protein PHYSODRAFT_470887 [Phytophthora sojae
g13887.t1hypothetical protein
g13888.t1RAW43620.1 hypothetical protein PC110_g161 [Phytophthora cactorum

Sequence
24545 bases(100 bases per row)
TAGGCCAGCTAAATGGGAACGCAGTGAACGTCAGCAACAAGATGATACACTTTTGGGGCGTACGACTTGACCTTCTCCACGTGCTCGCACGTGATGGTCC
ATTGCTTATCGTACTGCTGAGCAAGTTCGCGCATCGTATCTACCACACGTTGTTCCCACGCTTCGCGATCCTCCACAGCCACGTTGTCGTGAACGTGGAA
CCAGCCACCGCTGGGTTTCAGCACTTGCACAGCCAATGGCCAAGCCTTCTCACTCGTAGGCAATAGTCCCAGGTTCACACGGTCTGCCACGGCTCCGATC
GTAGGGGCCGACTCGCGGTTGTCACCGAGGTACACCTTGCACCTATCTGCAACATGGTTGCGCTCCAAGTTGAAGCGCAGAGCTGCCACTGAGTTCGGAT
TCCACTCGCAAGCGTGGACAAACGCAGCGCCTCCGTGCACAAGAAAAGGTAGAACGTAGTAACCAATGCCACAGAAGAGGTCCACGATCGTTTCCCCACG
GCACCCGATGGTTGCCATGCGAGCCTTTTCGGTGACGTTGCCAGATGAAAACATAACTCGCGTAAGATCCCAGCCATAGACGATTCCGTTCTCACGAATC
TCCACCCAGCCCGGGGCCTCTTTGCTGCGTTGAGAGGTAAGAGCCTTTTGATTTATGTACAGCAGCTCCACGTGACTTTGACGCTTTTCACTCGCATCAA
TGAAGGCCTTGCGTGCAACACGAGAGAATGCAGGCGAGGTGGACGCACAAACGTGTGCCCACATTTCGTATGCGAATGGTGCCCACTCTGGCTCCAAGAA
GGAATCACGAGGGATCAGCAAGACGTCGCTCACGAACTCGTACTTCTCTGGAATGGCCTTCACAACCTTGGCAGGGAGTCGATACTTGCTGGCAAATGCG
CCGATCATACTGCGGATCGCCTCGTTGCGGTTCAGCCCACTGGTCTTTCCAAACTTGTTTGCGTACGCATCGTCATCTTTCACTACCTCAAGCCTTTGCA
GTCCAGTCTCATCCGTCGAGGCAAGCAGCTCACGAATAGCTGGCGTGACAGGAAGAAGGAACACAGTCGTTGGCTTGCCTTCGCCCATAACCTGGCTCGA
TTGTGCAGGCGTTGCAACATGAACACGCCGGGACTTGTCGTACACCTGTGCCCTCTCCAACAAAGTCTTCACCTTCTTCACTTCTAATTTTCCAACGAGA
ACGCCTAGCGGCTTGTCATCCGAAGTGGGCAGCACGCTTGTAGAAGGAATATTCGCTGAGCTGGCCTTGACATTGTTTACAGCGGTAATTTTAGGGGCCG
CCAACGACAAGTGACACTGAAACACCGAAGAGTAGAATTGGCCGAAGCCAAAGCATTGGAAGCCACCGCCTAAAATGTAAAGCGATTTGTTGCTCGGAAT
CCAAGTAGTGCTGTGTCCCACAAAAGCAGCATTTTCATGCTTCAGTTCTCCCAGCTCCGTCCACTGCGAAGCCTCGACATCCAGTTTATACACTTTTCGA
GTCGCCTTGTCACCATTTGCAAGCAGAGCTGCAGTCATGCCGCCTACCACAATGACTGAGTGATCGCTAATTGAGGTAGCGCTAGCTGCAAAAAGCGCTG
GCGGCTGGCTTTTGTTACTGCCGTTCTCGAGAACCTTGCGTTCCCAAGTCTCCCCGACAGTATCGAAAAGCATGCACACAGCGCTATCGTCACCACTCTC
GCCGCTGCCATCCACGCCATCCAACGATGACATGCCTCCCCAGAAGACAAGCTTCGTCGAGCTGACAGCCACACCAACGTGATCAAAGCGGTGCGGGATG
CTGGATGTACTCTCTGCAGACAGAGAATAATAAATATTTAGTACACTCCGAAAAAATGGAGTAGGCTTGGAGTTTGACTTACCGATTCGACGCCATTGCG
GCGAGTTCTGACTGAGATCTAAAGAAAATAGATCTCCGAAAACTCGTTCAGCATCGCGGCCACCGTACACGTACACAACAGAGCCAACTGCAGTCACACC
AACACCAAGCATGGACAGAGGTTAGAGCACTTTGTGATTCCAATTCGTCAAGTAAGAGCTTACCAGCACAGCTGCTGTGCTTCCAACGTGGAGAGGGGCA
GACTCCTCGCGGATGAATCTGCTCCCACAGCTTGGTCTCAATATCCAACGCATACAGGTCGCCCAGGGGTTTCGCGGGGCTAGCACGACCACCAAATATG
ATCATGCGCGTTCCTACAACAACAGCGGAATGGTGCATCCGAGCTGATGGACCAGTAGCTCCAGCGGCAGCGTGGTACGTTTGCTTAAGAGAACCGTCAC
TTGATGGTGCCAGAATTGTCACGTCCGCAATGCGCGTCGTCGTTCCTGACGCAGTCGGTCCCTGTCCACCGAACACAATAATGTTGTCCTGATACTGCAC
ACTCGTATGCCCCACAAGCTTGACGCCGTCCTCGTTCGTCACCTCCGTCCAGGACCTCAGTTCAACTGAAGAACCACTCCCAACTTGCTTGCTCACTGTC
GGCTGGCAAAACTTCGCGAGGAAGGCGTCAAACAGTCGGTCCGTCTTCTGCTTATTCGCCTCAAACTTCTGGTTCGCGACATCCACGATCCATTGGAGGT
ACTCCTCGTCCACCAGCAACTGCTGCGCACTGCGTCCAAGCGGAATCTCTAATCCGTTCGCGGTTGTGCGAATCGCGCACATAATTTTCCGGTTACCAAG
CACGACCCCCGATTCGCGGAATCCGCTGGCGATGCCCCACTGCAGCAACTCCTTGGCCGCATCCAGGTCGCGACACACCACGTGCATGATGAACGGCTCG
TGCTTGAAAATAACCTGCAAAAGGCACAACAACCATCAGCTCAACACCATAAAAACAACCTAAAAGAGTAAAAATCGTCAAGTGTCAACCATGTTGCTGG
TGCTGGAATTGGCGTCGGGTGACTGCAGCGCCGCCTTCAGTTGGTCGAATGTGATGGTACTATGTTCGGCGATCAACCACTTGCCGCCTTTGGTGATCAG
GTCCGTCGTCGCTTCATTCCCATTGCCCGTGGCCGCTTCACCGCAGAAAACTGCAATTCGCCCCGAACACGAGCTGCTCGTCACCTGTAGCAACATGAAG
AACCCAATAAATGAGCCCAATTTCCAATTGCAATTGCACCAAGAATGATCACTCACGTAATTCGGGTGGTCGTTGATACTCTTGATCATGTCCACAATGG
GCTCGTCAATGCAGCCCTTGGGGCTCTTGTCCTCCATCGCCTGCAGCTTGCGCAGACTCTCGCGCTTGAGCTGCGCGAACATCGTCCAGCCAGCCACAAA
ATGACCGTCACAAAACCGTCATCGAATTTATTTTCCTAAGTACGTATCAGAATTTTCATTTTGAGTATCTACTCAAAAACTTTCCCTGCATCATGGCCGA
GCCGCGTCTCCGCGTGCGTTGCGCCGGCGTGCGCATGAACCAGCGCGGCATGTCCGACAGCGGGCACGTGTTCTTCAGCGAGACGCAGTACGCGCGGTCC
CCGTTTCTCGTGCGCGTGAGCTTCGACAGCGTCGCCTTCGTGCACCGCGGGACGCACGTCGTGGAGCGTCGCTTCGACTTCCCGACGCGCGTTTTGCACG
CAGTGCTGGCGGACTTCTCGCCGCAGGTCCTTAACAATACAATTCACCAATATGCAGGTGCGTCGCTGCCCCCAAAAGCGCGGAATTCGCCGCTCCATCC
CCGGACGCACCCGCACCTGTGCGTTTTGGTGCGCTCCGACTGCTTAAACATCTACACTGCAGCCGGACAAGTGTTCGAGGTGGCGCTGCCCTTCCAGGCC
AATAGACTTTTCCCTATGGAAGGCCGTGGACTGCTGCTACAGCGCAGTCCGGCGGCACAGATCCCGCCCACGGCTTCGAAGCGTCCGCGAGACGCGGCGG
CGGCGGCTCTGGCCAAAAAGAACCGGCGAGCGAGCACCAGTAACAGAGGAGATGGAGACAGGTACAAGTACAGTGCTGAAGACGATGGTACGCCTGCGAG
ACCAAGGTATTTTACGCTCAGACACCCGCTGGATGAGGTCAAGCCAGTGGCGAGCAAGAGTGAGGAGGAGTTTCTGGCGAGCTCCGCGTTAGAAGCCGTT
GCAGTGTTGGTGGAAGGAGCGTCTCTTGTTTTAGTGGCTTTTCATCGCTGGGAGCAGAGGTTTTGCATGTTTCGACTGAGTGAGGTGGAGAGGAGTGGAA
GGGATCAATTGATGCCGGAGGTGCGGGTGGTTGATGGACCCACGTGGACGAGATACCGTGCTAGGATGGATTTGGAGGAAATACGGGTGCCGATTGAACC
CGAGTGGCTCGCGACGCCCGTGTGGAAATCTCCTCGAGTGGGACCCGCGACGTCAAAGCCGAGGTTTCTGTCCTCGATTATTTCTCCGCCAGCGGCTTCA
CCTGCACCGCCGTCGCCATTGACGGCTACTCCGTCGGTTTCGTCAAGGAGTGATTCGAAAGTGGCTTTCATTGCGTCCGGTGTTGATGGCTGCCCTTTGC
TCTGTATGATGGACAAAGGGGTTGGAACGCTTCTTTTGAAGCCAATCTCGCAGCAAGAAACTGGTACTGCGATGCTGGCTGAAGGTGACGGTGAAGCTGG
TGGAGTTCGTATATTACACTGCCGTGACGCTGTTCCGATCTGTCAGCATACAAGGCGATTTGAAGGTGGAGAATGTTCCACAGACAATATTCCAGGTTCC
ACCGATATTGTAGTTCTAGAAAAGGATGGCACGCTGATGTTATATCGAGCACACCGTCCTGTTTGTCGCCTCGATCTTCCTGCTGTGGAACAGGATTGCT
TCGTTGGCAGTGCTGCAAAAGATGGGGCTTCGGAAATAGTACGGCTGATGGGCAATGTTCAGCTAAGCTCAATTGACCGAGGACATGCGTACGAGCTCGT
GTATCCGAATTTACGCAGCAGCAAGAGCGGAAAGATTTGGCGGTGCGAGCACCCGCTGAAGGTTGTGAGCTCTCCTCTTTTGCAGCAGGTTTTCGATGTG
CTGGATTGTATAATCCCACCTACAGAAATGTGCGAGTTTAAAGCACACGTGATTTATCGGGCTCAACAAAAGACTCAAACAAATCGGAAAGATGATCAGC
TTGCAAATGGTGGGGTCGAATGGCAATCTTTTAAGGAGTGCGTCATTAATATGCTGGAGGAAAATGCTGAGGGTAAGCCAGCAGCAGGAGGGACTGGAAA
CGACGAGGAAACGGCAATCTCGTGTTTTGATGCGCTTTGCCAGAGTGAGTTTCATGGCATGTATCAGTACGAGCATGCAATGCTTTTTGCCACGATGGAG
CTGCCCATCGTGGAGTCAACGACAAACAGATCTCCCGAAAAAATGCATACTGACGACATGCGCCAGTGTCAAGCAATGAAGAAATACTGGGAGACAATGT
TTGCGGGGCTTCATTTACTCTGTGAAGACCTGAAGTTGTCGATTACACTTGTTCAGCAACGTCTGCAACTAGTGGACATGCTGATGGAAATGTCGTCACT
ACTGCGTTTGGATTCCTTTGCTGCTTATTACAAGAAAGATAACTCTGTGCTGAGACGGCAAGCGAATATGACGATGGAATTTCGATTGCAGGCACCTACG
CTTGGAGAGGGGCTACTTCGCTTTACTTCCTACGGTTGTGTGCCGGACTTGGTTCTGTGGCTACAGAGCAAGATGACTGCGAAATCGCAGAGACTGGCAG
CGTTTCCCATGTTATTGGAGGATGATGATCCGCGGCAGTTTTCTAGAATTTCTCCAGGACGTTTTGTAGGCCCCTTTCGGAGGACAAGAGCAGTTTGTCA
CGCATACGAGCTGATGTTTCCAAGCTCAGAAGAAAACGCGCAGACAAAGGCTTTCAACCTGATCGTTTACCTCAGTCAAGACCCCATCGGTAACGCTCTG
TCTCTGGATGATCTTCCGGTAGGTTTAAGTTTTCCGATCGTGCAAACCATTCGCCACGTGAAGCACCACCCACCCCCTTCCATCACTGAAGACGTGAGCG
CATTTGTGGGGCGAGAGGATCTCAGTATTGCAAGTGCGGAAAGCCTGGCAGATCATGTTGACTATTCGACACAAAACCAGAAACAGCATGATCCAAAGAG
TAAAAGTCTTGATCTCACTGAGGACGACAGTCACGACGACTGCGACGGTCTTGAAGACATTATAAGTCGGAGTCAGCCCCTCTTCCCTACCGACCAGAGA
ATGAAGGAGGTTGCACGTTTGCTTCGTTCAAGTCGCCCTCTCTGCCTGAAATTAGAGAAGACGCCGGATTTGTCAGACCTGGACTACGCGCAGCAGCAGC
AAGCCCGTTTGTTGCTTCTCTGTAAACGGTCTATGGCGCTGTCTGTGGCGCGTGGCATGGTCACACTAGGCAGTTTTGATGTTTCTGCCGCGCAAACGCA
GATATGGCGACTTTCTATACCTGCATTGCCTCTAGTGGGTCGTAAACCGCCGGCAAATGCGATTGTGGAGCTCGATCTTTCCGGCTACGCCAAAGAATTG
ACGTATTGGCCTCAATTTCACAACGGCTGTGCTACGGGTCTACGGCTTCCAGCGCATGATCTCTCGGGCGTCGTCAATCGTCATTGGATTAAATACCATC
GACCTTCAGTGAACGATGCTCCACAGCGAAACCCAACGGGAAGTCAGCAGGCAGCAGCGGTCCAGTCGGTTGACTCTGCCGGCCGTAACCTGGAAGAGGC
ATACGCAGCTCATGCAGGGTTATTGCTGGGAATTGGTCTACGCGGTCACCTCAAATGCTTGTCCATGGCAGATGTGTACAACTACCTATCGCTGTCGAAT
GAATTTGTGACTGTGGCGATCATGCTCGGTATGGCTAGTACCGCTGCTCACTGTCGACGCAAGCGAAAGCAGAAGACCGCAGCAGTGAAGCCTACCATGA
CGGACGATGAGCAAGCAAGTGGAGACACGGAGGAACCATCGCTTGGCGCCGATCATCTTTTTTCAGGTTTCCCAGAGCTCTCATCATCCGATAAAACTCC
GCTACTCGGAACGGGATTAGAACTGGCACTGGAGCGATCAGTATCCAAGATGTTGTGTCTCCACGTTCCATCGTTGCTACCACCACCATTCGGAGGGTTT
TCAGTACCTGCATCCACTCAGACGGCTGCATTGTTGGGACTCGGCATCTTATATCAAGGCACGGGTTATCGCCTGATGACAGAGTTATTGCTTACGGAGA
TAGCGCGTTCTCCATCAAGCGCCCAATTCGCAGGGAACAATGGAAGCGCGGGTCTGTCAACAGGTTCGTTCGATCAGCTGGAGGGTTACGCTTTGGCAGC
AGGAATGGCGCTAGGCCTTGTCGTACTGGGGCGTGGTCAATCTACAGCAGGTGACCCAGGACTGGCTGACTTGAAGCTTGAAGAGAAGCTTCACAAGTAC
ATTGTCGGCGGAGCCCAACAGTATCGGGATACAAACGTGGCTGGAAGCTGCCTCTATCGTGGTCGCCGTTGGCAGGCATTTGGCAGCGGGGGTAATGGTT
TCAATTACGCAGTAAACGGCAACCCCACGGCTAACGACACGCCTAACAGCAATACCGGAGCTTCTCCTGGCGCTGGCCGTGACGCAAAACACGTGAACGA
CCGCGGCGGGGCTCGTGGCGGTGGCGAACACGTTAACGTTGGAGTGACTGCGTGTGCAAGCGCTCTGGCACTAGCATTCATGTACATGCAGACTGACAAC
AAGGCCGTGGCTGCGCAACTGGTAGTCCCCGACACGCTTATTCTGCTAGACTACGTTCGCCCTGACATCTTGCTGGCCCGCACCCTAGCAAAGAACCTAG
TAATGTGGAGCGAGATTTCGCCAACTGTGCAATGGATTGACCAGCACGAAGTCCCAGTGCAGCTACTTCAAGCATACACATTTATCCAGCCGCAAGCAAA
TGATGCCAAGGGGCAAACGGAGAATCCTAGCGCCTCACCAATGCACTCTGACCTCCACTCAATTTGTGAGGCTTACGCGAATATTGTTGCAGGGGCGTGC
ATGAGCATTGGGCTGCGGTTCGCCGGCACAGGCAACGTGACCGCTCGAACTACCCTTCGCAAGTATGTTCTACATTTTCGGGAGTTAAGAGCGAAATCGT
CGTCGTCTTCTTCCTCGATGCGTCTGCGAGGTAGTAACAACGTCGTTGCTGCTGCGACGGAACGTGCAACTATCGAGAGGTGCTTAGCTGTGTGTGCACA
GGCGCTAGCCCTGATCGATGCTGGAACTGGCAACATCGAAACGTTGACACTTTTGCGCTCGATAACATTGAGGCAGCGCGTTGATGCGGGAATGAGCTAC
GGCAACCACATGACACTCAGCATGGCGATCGGGTTGCTTTTCCTCGGTGGTGGCCGTGCCACAGTTTCACGATCGAAAGAAGCTATCGCGGCGCTCGTAA
TATCGCTCTACCCGATGCCGCCGATGAATACGGCTGACAACAAGTATCATCTACAGGCCTTCCGCCACCTTTACGTGCTAGCGGTGGATAATTCTCGATT
GCTGGAGACTGTGGATGTGAACACTAAAAGAACCTGTGCTGTCCAAGTTCGAGTTGATCTTCATCCTGTCACACTTGGCTCTAAGAGTGAAACTCAACCT
ACGTGCAAAGTGTTACGCAGCCCGTGTCTTCTTCCGGATATTGCAACAATCAAACGCCTCGTCATCTCTGAACCGGATTTCTACCCGATTGAAATTCTCA
CTTTGCCGCCGTCTGAAGAGCCAATGTCTTTGAAGAACAGCAACATGAGAACGGCCAACGCTCTTCGGTTGGAACTCTTACAAAACAAAAACTTGGTTTT
TCTGAAGCGGCGACAACGTAAAGACTTCGGGGGTCTTGTGGATCTCCAAGAAGTGCACAATGGACACGTGACAGCCCGGGGTGGAGGTAACGACGACGAT
AGAATGCGGAGACTCTTTCGGTCCTACTTCACGACGGGCAATAGTGGTGACGATGATGACTGTGAAGACGGCGAAGATGAAGCGGGTCAATTAGACGTGG
TTGATTGGGGAAGTAGTTGGTGGGCATCCCAGTTAAACCCACGAGGACTGGAATACGTCCGAGAAGAGGCACAATTGCTTATGCCGCCATACTTGAACGC
CTTGCATGCGCTCTTTCGGCTGCAGCTAGTGCCGCAGTTAGCATGCGCCACGGAGATCGTGACGTTGAGTCTGTTCAGTGATTACTGCCGCCTGCATGCA
TCATCTTCAGCGTCAATAACCAAGGACCCGGTCAGACTGGAGGGAAAACCTTCATTATCCGATTTTGGCGTTTGGCTCTCGAATCAAACCGAGGAGGCCC
TAGGAGCACTTTGGCATCGAACGTCGCTGTCAATTACTTCGCTGGCTTCTGCGCGAGTCAAGCTACTAATGGAAACCCCATCATCGTCATCACCGACGAA
AAGAGCCCAGTCACTGGCGGATGAATTCTTCGTCAGTGTTCTGGTGCGCTATTTTGCAGGTCCGTCGGTGTCGTCACTACCACTTGCAGAACAACCCCAG
CGTGCAGATAAAGATTGGAAGGCCAAGTTTCAACGAGTACTTGCTGCGTGTTCACAAGCTCAATCTCAATCGCTGAGCATGACTTCGGCGCCAGCACGAT
TCCAGTTGTCAGCATTCCTCGAGCAGAATGAGCTTACGGAAGCTGAAAAGACTTTCTGGCTGAAGTTGGTATCGTTCTTCCTATTTTCCAACTAGCAAGT
GAGTGCAGTCGCAGCAGGTAACTACCATGTATGCATGAAAAGACTGGGTTTTGCTAGTGTTATTTAATTTTTATTGTCTTGCAGGCTGAGCAATGGGAGC
TGCATCAAGATGACAGCCACCTCTATGATCCACCTGCAAGTGTGTTTCCTATCTATTCACCCCGGGTCGACGAGAAAGAGAGTTCAATCTTCGTCAAAAC
CGGTGACGGCCACCGCCTGCAGTGTCTTGTCTGGTAGCGCTTCGTCGCTGTCGTTCGCGAGCCTGGAATCATGATCATACGCACATGAGGCTGCTACTCG
CTTCTCAAACAGAAAGTCTGTTCACACTCACCATATCGCCGTTCTGCACGCTTCATCATGGTTGTCGAGGAGTGTCCGCGCAAATCCTCGCTGCTGCTGC
TACCTCTTTTTTTCTGTGGGGAACTATTTTCTCTTTTTTTTTTTCCATGGCATGGTGTTCCTCTTCTTTTTTTTGCCACGTTTCACCCACGCCACTACTG
CCCCGGGCACAACCTCCTCAATTCAGTTTGGCAAAAGTGATTTTCATTTTACGTCTTTTGCGTGGTGACGACACGGCTGGGGGGGCCGCCGCCTGCTCCA
CGGGCTTCTTCACCACCTTTGCGGGAGGTGAAGTAATCCCTTGAGCCGACGCACCATTTGTCGACGTATTGGCAGAGTTGTCAGCAGCACCCAACGATTT
CCCGTCCGGGCTGCCGGATTCAACCACAGCCTTGCCATCGCGATCACGCTTACCTGTAATTTCTGGAGACGCCGACGACACCGTCTTCTTCGGCTTCACA
GGAGTGCTGTGAACAGAATCAGTGCCGTTTGTCGCCTCACTCCCGTCAGCCGCAGGATTCGGGCTACCTGGTTGCGAAATACTGCCCTTTCCATTGGCCA
TCTCGGTTGCAAGTGACGCTGCCTGTTGACTGCTGCTCAAATCCTCCACTCCATCCTCTTGTGAGTGCACACCTTCATCACCCGAAGGCGGAGGGCTTGG
TGCCGCGACCTCCTCGGCCTTCTTCTCCTCTTCTTTCTTTTTCTTCATAAACTCACGACGGACAACACGTGCAACAGCGCGTCCACCCATCTCTTCGAAC
ACACTCTCAGGCAAAGACTTCCAAACAACCGCAGTAACTCTCACGTCCATGGTCGCCGTTCGTTTGTTCCAGCGGTAGAGATCGTTGTTCTTGAAATACT
CCACCGAGCTGTCAATGCTCACTTCACGACTGCGCAGCTGGCGACGGTCAATATCAAAGCCCACGTAGAAGCAGACGCCGAACTTGCTGGGCTGCGCTGG
GGTTCCGCCGTTAGACTGCTCATTCGCTGGAGCCTCACCACCTGTCACAAAGTTCAGTGGGTACTTCTTCGTGAAAGCGCGCAAACGGCAAAGCGCCGGA
TTGTAGGCGAGCGACTCCACCAGCTTACGCATACGAGACTCGCAAAACCCGCACCACGCCTGCTCCTCGTCCTGCTTCTCCGTGTACACCTCGACTGCGA
GGTAGTGTTGGTGGACGGCGAAAAAGTCCGAGGGCTCAAAAAGTGGCCCCCATTCCGAACCACCTTTGCTCAGCACATCTTGCACAATGGTCAGGCCGCG
CTTAAACTCCTCCTTCATAACCGTAAGACTGTGCGTCGACACGTTAAACGAGGAATTCATCGACGGGTACGCCGGCGTCAGGATCGGCATCACTTGGTAT
CTAAAAACACATGAGCAATCATCCAAACTCAGTTATTCGTCTAGAAAAAAAAGCTGACAGCAATCTAGCCAACTCACCGGTTGTGGCCTGCGTTGGCGTT
CCAAATTTCCAACCCCAAATTGGCGTCCTGTGTCTTGCACAACTGGATAGCGAGCGGCCACTTCCAGTTGTTCAGCACCATGAAGAAACGCAGCAGCAGT
GTCGACGGAGCCGCGGTCGGGTACAGCTGGTTGATGAAGCACACCAAGATGCACCAATTGACACCTCCGAGGTAGCCCATCTTGTTCGAGTACAGTCCTC
GACGTTTGGCCCAGCGTCTCACAATACGGAGCACGCCGATGAAGCTCTCCCGGTTCGGGGTGAGCTTGATCATGAGCTCCGTGACTCGAGGGCCATTGAG
ACTCTTCTCGGTGGCGGGGTCCACGCCCACAAGCACATGGTCGTCCAGAATATTTAAATTTTCAGGGATTGAGTTCCTCGGCAGGATGGCAATTTGTAAA
TCAATGTTAATCTCCTCGTAGTCGAACGTCAGGATGGGCACGATGGCACCCTCAATAGCCACGAGGTTCGAGACCTTGGGGTGCTGCAGGAAAATGTCCT
TCAAGGACGAGAAAAAGTCCTCGCGCGTCACGTGGCGCGGCGCCACGCAGATGGTGTCGATATCCGCGCCCGGTTCGTTCACCCCGAGGCGGTACGAGCC
CGACACGAGGATCTGGCCGCCGGCGTCGGCCGCCATGTCCTCGGGCACGCCCTTGTCCATGCACACGCGCTTCACCCATTGGCGGAAAATCGAGCGCAAC
TCGGCCAGAATCAGCGAGCGGCGCGTGATGTTGGCGTCGGATTCCGTGGGGAAGTGCGCGTCCATGAAGCTTTGCAACTTGGCCGACTGCTCCAGGTCCT
TGGGCTCGGGCGGCGTCGTGCGGATGGCCTTGTACGCCTGCTCCAGCACGTGCGGCGCCACGGTGAACGTCGCGCTCTGCATGACGAGAATCGGCGAATG
AAGGCAGCCTGTCCGCAGTCCGTTTCGCGCTAATCTGCTTGTGTCACTCAAGGTGAACAATGCCAGCGCTGTCTCTGTGTCGCTCATTGGCGGATAAAGC
TTCTAGATTTCATTGGTGGAAAAGAAACATTATTTTATCGACCAATCAAACAACATTTGAAATTGAATTTTGAATTTGCAGCACTTCTCGTGGCCGAGAT
GGACGACATTGAGGCGCTCATGCCCCGCACCAAGTACGTGCGTGTCCCCCTGGTGCTGGGGGATACAAGGCGATAATTGCTGATATATTGTGTGTGCAGA
GCGGCTAATGACCGAGCGCCAGTGGATGGGGCCAAGCTGCGACAGTACATGGCCACCGCCAACACTGAGCACGTCGGAGCGTACGGAATCTTGCGGTCAT
TTATCGTTTTTTATTTTCTTATTTTATGTTCATAACATTGTAGCCGCTCCGGTGTCGTGGTGCGCGGCGATGTACGCAAAGACGCTGAAGGGTTCGAGGA
CATTGACGACTTTTGGGTCGACGAGGACTCGCTGCAGGACGACTCGGTGGACGATGACGATGACTGTGCGCGGCAGTGGCTGCAATTTGCAGGAGGATAA
GAGATGCTGACCCTGTTTTTTAATTTTATTTTGACAGCACTCACGGTGTCCGATAAGGATGAGGCGGATACGTCGGGGGACATATCGGAGCCGAGCGAGC
ATGAGGTGGAGCTGCCGGAGATTGACAGCCCCGTGTCCAGTGGCAAAGACAGTATAGACATTGAGCGAGGATCGATTCCAGCGAGATCGCAAAGAAGCAG
TGACAGAGGGATTTTGGATATTGAGCGAGGCTCGATTCCAGTGGCATCGCAGAGAAGCAATGCCCGAGCGGAAGAGGAGAAGAAGGTTGGTGCATCTGAA
TCGCCGCCGCCGTCCCCCGCACGGAGCGATATTTCGTTTGATTTTGGTGGCTCGCCGCATGGCTCCGTGGATATGGATGCAAACATCACTGTGCGTGATC
GACGCGGCAAGAAGTCTACTGGAGCTGGTGGGGATAAGGCAAAAACGAAGGCTCGCCGGCGAGAATCTTCGGGCGCCGTTCGCGGCTTTGATGAGGATGC
AGCGAGTCCGTTTTCTATGAACGATGGGCCGGTGACTCCACTGTCAAACGGTGCGTGGTGCTTCCGGGTTAATGCATTTTATTTTCAGCGATGACTCATT
ATACTGCCTTGTTTTTTATCTTGCTGCAGCGAGCGACCGTACGTTGAAGTCAATTCCGTCATTTTCGGGAAAAGACTCGGTCTCGCCGACCATCACCAAG
GAGTTATTCAAGGAGGGGGGATACCGCAGCGATGCCAGTGAAAGAAAACCGAAGAAAAAACAGACGAAGAAGCCGAAAAAGGCTGCGGATAAGGGTGGTC
GCAAGACACCGCGACTGCGCCCGACGGGAAAATATGGCTACCGGAGTACTCCACCCGCAACCGATACCTCGATCCAGTCCGTGCAGACTGACGATGATAA
TGACGAGTCTTTCGAGGCGCAACACGACTCTGGTGGCGAGACAGGAGATGACAGCTTTTACAATGAGCCGGACGCGCCGAGTGGCAGGGTTCGAGACAGG
TTACCTGACGCCTCTAGGATCTTGGATGACGACGAAAATGATGAAGCTTGGGATGGCAGTGGCCTGCGTCGGTCGAAGCGGAAGCGTTACAAACCGCTTG
CATGGTTTAAGAGTGAGCACATGGTGTACGAACGCACCTTTGTCGGAGTGGGAACTGTGCTGCCTACGGTTGTCGGCATCGAACGTCTCGGTGCTGATTC
TCCAACATCAAAACGGACGAAGTCTAAGCCTCCGTCGAAAAGGACGAACAACAGCAAGCCCTTGAGACTGAAAGATCTGCCCAAGGACGTGCGAAAGCGC
ATCGTGGATAGCGAGTGGGCGACGCTTTACGACGGTCAGGCCGGTTGCATGAACGACCTGAACATCATCTGCCGCTCCAGTGAGATCCGTCTGCGTAAGC
TCCCCACGGAGGAGAGAGGCGGTGCAGTCGTGCACGCGTACGCGGGGCAGAGTTTCAACCTTTTTAGTCCGTCCCCTTTTGCGCGGTGGATCTCTGGACG
TGTAGTATTGCCTCCCGGCGCGTGGAAGGAACCAGAGGGTGTTGGTCAAGCCGTGCAGTTGTTCTACGTAACTGGATGCCAGCCAAAGTCGCTGGAGTTG
GCGGTGGCGCCCGAGACCGATGACGACTTTTTCACCAGCAAGCACACGACCCACTTTATGCTAAGCCCAGGCGACGAGTTCTACGTGCCGTCTGGTAATG
TGTACTACGTGAAAAACCACTCGGGCTCTGCGGACTGCGACTTGCGGTTCACGATTTTAAAGCCCGAGGCGCCGCAAATGCCATCCGACAACAATGACTC
CGATGCGGAGAAGGAGGAGACGAAGCCTGATCCGGAGTCAAAACCCGAAGCAGCAGAAGCACTCGACAACGAGCTGAAGCGCAAGCGAGAGGAGGACGTG
GACTCGGACTCGGTTTAGAGCGGTGTGCATTAGTGCTAGCAGCAGCAGTCTCCTTTATTCAGTACTTTGAAGTAGATTTGTTTCCTCTTGTTGTGGTGGA
CCGTCTCCGTCGTGACATTGCTGTCACACAGTAGGACGAGGAGCCGGAAAACTGTCTGACTCAGCCGGATAAAGCACCGGCTCCTGATTACGATCGATAC
GGGCATGGCATCTTCGTGGTGGTCTCCAATATGTAGCGGCGTCTCAATTTCAGAGACTCGCATGGCAAGGAAATAAAACTACCATCGCCATTGGGTTTTG
CGGCCAAGTGTCCACACGCTGTGACGGTAGCACGTTACAGCGTTTGAAGTTATGCGCGAAAACGACGTCGTGGGCCACAACTGGTAAAGCGTCGTCAACT
CGAGCGGCGATCTATGCGCGCACATGCGCATGGGCGCGGGTCTGCTATAAAAGCAGATGGAGTCTGCACGCACGAAGCCTCTATGGGTAGGTGAGCGAGC
ACAGCTGGAGGGCCTAAGAATACGCGTGGCGCGTGGTTCGGTGTCTTGGTGTCAGACCGAAAGAGAGGGGACGAGGTTGTCAGTGGCAAAGAGACTGAGT
GTCGGACAGCCAGAACACCAGCAGGTGCCGGCAGACTGCTGCCTGTCCTATACTGCCCCGCTAGCTTTCCGTGTTGCCAGCTCCCGATTGCTTATTTATC
GTTATTGCGCGTCGATCAGCTTGATTCGCGCTATGGATCCTGCAGCTTCATCGTCCAAGTGCGTTCTCAGCTTGCTGGGTACTGGTTGCCAACTAGATGT
GCTGCTCTTTACTGACGTATGGGCTGCGTCTGCGATAGGATGGACGACGTCTACGAAACCATTAAAGAAGGAAGCGTGGCTGTCCGAGGGCATTTCATGG
TACGAACGAGTCCAGTGTGGCATGAATTGATAGGAATATCGTGGTCTCACTTGTTGTTGGCCAACTTTGCAGTGGCGTGATCGCTACGTTGGTATCAAAC
CAGGCGAAATGATCATTCGTCGCCGTCGAGACGGCACCATTAAAGCCAAGGTTTGTGTCACAACTTCGTTTATCGAGACCAAGCTCGTTCTCATTTGTTG
TTGCTGCTGTCAGATCGACTTGCTAGACACCAATATCAAACTCACGTTCCTCGGCGGCCAGTCCTTGCTTACCATCGCTATGCACGGACGGGATACTGTT
TTGGACTTTCGCTCTTCAATTACGCGTGACGAGTGGATCAGTGCTATCGTAAGCGCACAGGAGCGCCCTGGCTCGGACGCTGACTGCGACGACGATGGAA
CTGAACTTCTTTCTGGCGAAGAAACAGACGAGGGACACAAGCGTAGCTCCATGACGAGCTTGGGGACCGAAAAGACCGACTCCATAGCGGAGGATAGCTA
CAATGATGCACTACTTGCATTGCAGAGCGTACGTGATTCCGTAATGCAGTGTCATCTCTCGATGAGCGCAGCCGAGGTCGACTCGTTCATTAATCCTTGC
GATAACCCCATCGCAGCAGCAACCTCAAAAACGATTCCTTCACTACGACGAGCCCAAAGCGCGACGCGCAGTGAAGAGGAACTTCGACAGAAACGCCTTC
GAGCACTGCTGACGATGATCGAAAGCACGCCTCACGGAGGACGTGTTGTGCTCTTGCACCTCGGAGTAATTGCGTCTGCAGGCATCACTGTTGGCGATAT
GCTGTTGGCACTTGGAGAAAAGCAGCGGGAAAACCCACGTCGTGGCTCCTTCACTCCGCGTACGCTGAGTGCCCAAAAGCACAGCATTGCGGCGTTTGTG
CGCGATATTTTGTTCCACCCCATTTACTCGAAGCGCGAGGAGGTCAACACCGAGATTGTTCAGGGGCTCATCGACTTGTTCTTCCCACATTGTCGGTTGA
GGCGGTTTAGTGATGATACGGAGTGGCATCAAGTCCAGCCGTCGGCTTCGGTAAACAACACATCCAGAGTTACAACAAAAAGTGAAAATGATGCTGACGT
TGGTACTGCAGTTCCGACAACCCCGACCGTAGCACCGCCAACTCCTGCATCGCGTCTTCAGAGGCGAAAGCGACGGAATCACTCGTTCCCGAATCTGGGT
GGTATATCTCAACTCACCAAGAGCAAGGGTTTGAAACAGACCTCGGTCGATGACAACGACCGATCTATTAGCACGCGCAAGTTGGAGGAAGGCAGCCAAC
GGCTACGTGACAATCTGTCTGTGCTGTTCGCACCATTCCCAGACAGCAAAGGCCCCAGCAGCGGACCAACTCCGTTTGTGAGTATAAGCACACCATTCGC
CTCCGACTCATCTGATGAACTCGATGTAGTATGCGAGGACATACCGCTCCCCCAGCCATTGCGGAAAGTCTTGTGGGAAATGTCGTGCTCAGAGTTAGCT
GAGCAGCTCACGCTTTTTCATCACTCCCAACTCTCGAACGTGTATCCGTGGGAGTTTTTGCACCACCCCAAAGAAGCTGCCATGGAGTTGACCGAGAACT
TCAACCGGTTGGTAGCATATTTCGTCTGGTCTGTACTGGTCGAAGACTCTCCAAAGGAGCGCGCAGAGGTCATTGAGAACATTATCTCCATTGCGATGGC
CGCAAGTGCATCCCCGCTTAATAACTTTCACCTGGTCATGGCTTGCGTGGGCTGCCTCGGAGATACGCCGCTGATGTCTTCACGGATGCCGATCACGTGG
AAGAAAGTTCGGGCCAAGTACAAAACTCGTCTAGGTGAACTTCGACGGCTGTGCGACCATACCGGCGGCTTTGAGAACCTGCGACGCAAGCAGAGCACTG
AAAGTGCACGGCCCATGCTTGCCAGCGACGTATCGACTGTCTCCATTATTCCCTTCATCGGCGTTATCGGGGTCATGCTGGAGCGATTGCGATCAATCAA
CTACTTCACCTCGAAGAAGATGTTGGACTTGGAAAAACTTGAGCGGCAATACACGGTGCTCAATGTACTCGAGAACGCGTTGCTCAAGCCCGCTCCACGG
CCTTCTCGGGTGCCTCAACGCGGTAAGGTAGCCCCCATGGAATCGGCGACGGAAATGACAGCTCGCTTGCAACATTTTTTCCGGACACTCAAAATGGACT
TTGCCTCGCCTCGACTGCATCAGCTACGCTCGCAGCAAATTTTGGCAAGCGAAACGAGCTCCACGAGCTCAGCGTCGGCTTCTTTTGTATTATCAGCAAC
CGTCAACGGGAGTAACAGAGGCGGGGCCCCATTGACTGCAACGACCCTGGCAGTGAGCAAATATGACGCGCAAGGTTCTGTAGGTCCAAGTGAAGACTCT
GGTTTGGCATTCGTGTCCTTCCGAGACATTTGCGTGTTGTTAGTGTCTGTCCCGGAGATGCGTGAGCGAATGCAGATGGCTCTCGAGGCGCTCTTCGTAG
ACGGTCGTCAGCCAGCAACGCAGTTCCTGCGCAAGTTTTGGCTCGATTTCAAGCAGAACGTCTGGGTGTCCGGCGTCGGCCCCACGCTCCAAAGCGTACG
CGTCTGCGTGGCCGCCCTGTACCAGGAAGTCATGGCGCACAAAATCACCGAGCTCATGCAGATCAGCGGACTAGACGAGAACTCGGCTGAGCTGCACGAC
GTGGTGTACGCAAAGGCCGTGGTGTTGACCGTGCAGCCTATTTATCTGAAAATCGTGTCCAAGGTCAAGCGCAACTTCGTCAAGGAGGACGCGCACGCAG
CAGCACGCCTGCTACAGAGTACGCCAAAGGTTGTCGTCGACACGAGCCTGCCGACCATGCCGTGGAGTAGTTGCAGCTGCACTTCTCCCGTCGAGTTGCT
GGACCTCGTGTGCCAGTTGACGACGCTGCCTCGTGCCAGCACCACCAGTGCAGCCACCGCTGCGACCGACCACCAGCTCGCGGCGGTGGAGCTGCTGGGC
GCTCTGCAGCATCAAGCGCGACACACCTTCCTCGCCACGAACCCGGTGAGCAGCTTGTACCTCATGAAGCAGATCCTGGACCCCAAGTACCTTCCTCTCG
CGCGACGACAAGCGCTCGAGGTCTTTGTCGCGGCGGTCACGTGGCTGCGCAAGGAGCAGAAGCTCTCCTCGGACGAGGCGCCGTGAATCTTCCAGCGATT
GCACGCGCATGTACCGGTACAGACAAGGCCTGAACGGATGACAGCCTGGTGACGCCCGACGCCGACCGAATGAGTGCACGCACACGTTGTTTTATGGCAG
CGCATGTTTCCTACAAGAGCCATCCATCCCCACTGAATTTCGGAGAGATGGCCAGAATATATTATCTCGCGCTTGCCATCGTCCTCGTATCGTATCGTCC
TCACCGTCTTGGCCCATTGCCCCGAGAGTCAGGGCAATGTGCAATAAGCAAGTGAAGGTGTCAACGAACTTCCAGCAAAAAAGTATCTTTTGTAGCACTG
CATAGCCGGGGCGGACGTCCTTTCGCCGGCCAATAGAAGCGCCGATCTTGATGCGCGCCGATTTTACCCACTCATCTCGCTCGATGTCGCGATATTCCCA
TTGGCTGAAAACCCGCACAGTGGGCGCACAGTAAGCGTCAAAAGTTACGGCTCCATGTAGCGTGGTGTCGTCGCTCGCGACTTTCCTGGCGGAACGAGCG
CGCACTCGTCCGCCAGCGCCCCATACAATTCCCTCCCTAGACCTTGGGCGCAAATACACCCCCCTCTGATACGCAGCCACTTCAGCACTGAAGACAGAAC
CCCCTCCCTCGATTTAATAACCCCTCGGGTATGCGCGTGTGGACTCTGGCGCTCGGTCTGCTGCACGCCGCGTCGGCCGCCAGCTCCTCCGGCTCCGGCG
CGAGCGGCACGCGCAACACGCTCACCACGAGCTGCAACGGCGGATGCAGCAACGCGTGCGTCGTGGTGGGGCAGTCGTCGGCCAACGCCATCGACTGCGT
GAACGACACGAGCTGCGTGACGCTGTCCTCGGGCCAGTCGGCGCTGTGTCTCGACGCCTTCGCCTCATCGGCCACCGAGTGGACGTTTCAACCGGCCGAG
AGCAACGACACAGCAGGGGCCGGTCCCTTTGAACGCGTGGGGCTGCTGCAGCTGGACGGCCAGGTGACAGACCTCACGTTCGCCAAAGCAGAGCAGAATG
AGGAACCGCTCTCGGGAACGCTCGAGCTTTCGTCCATGAACATCCAATCGGATGCGACGCTGGACAAAGTGGCGTTCAGGAACTTGAGCTTGTCCGGTTT
GGACAGCGCCTTACCGCTCAACAGCGTCAGAAGAATGTGCGTCGCTGTGATGTTGCACGAGGAAGAAACTACCACGACTGACACTGGTATTTTATGTGGA
CAGATATTTCAACAACTGCTCCTTGAACGCCATCCCTACGGCTGCTGTGGCTGGAGACTCCGTCACTGTCATGTAAGAGCACATTCGATGCACTGCTTGC
AGAACTTGTTCTAATTTTCATTGTTTGTGGTGCAGTGATTTAGCAGGAAATGCCATCGCGGGGGTGGAGAGCGATTTCCAAGACGAGTCTTTCCCGAATC
TTACTGTACTGTACGTGCCAACTTCTGCTTTAACCTAGACTGCACCAACATTGCTAACTGAAACATGGTGTCTTTCGTGCAGTGATTTATCGGCGAACAC
TCTGACGGACTTCGACCTCGTGGTAGACAACTTTCCAGCGATCACGACCTTGTAAGTTCGCCTGCGGCGAAGTGTGCGCTGCTCGTAGCAAGCTTCCGAC
TCACCTTCCTGTATTCGTGTGCTTAGATTTCTCCACGACAACTCGCTGGCATCTGTTCCCGACGTGGTCTTCAATTTGTCCACACTCCAGCATCTGACGC
TGGCCGACAACCCTATCAACGCGTCGGGTCTTACAGTGGACCAGTTCGCATTCCTCGCGAATCTGAACGTGTTCACTATTGATGGCACCACAAACACGAG
CGCATGCCCAACCTCCGCTGTCCAGACCGCGCTTAACGAGTCTTTCACGTTTTGTGCGGGGAATGGAGACGACATAGAACCCTCAAACGCGACAGTCACG
GAGATGCCATCGACTACGGTGCCTTCAACAACTGAAGGTGCTTCATCTTCCTCTTCGTCGCACAAAACATGGATTATTATTGGGGCGTGCCTGGGTGGCG
TGGTGCTGCTGTTGCTGATCTTCTTCATATGGTGGTGCTGCCGTCGGCGGAGGAACGAGCAACCCAAGCTCATGAACAGTACAACTCCATCAATTGCAAT
CGGCATGGGCGACTTGTCTGACCACCCCTACATGGAAATGGGTGTTCCTCGATCCACCAACGCCTCTAGCCAGACGACGTCGGACTTTGAATTATTGGCG
TCTGTGGCAGACGGCTATATCGGACTTACTCGGCTATCGTATGACGACGTATTCCTGCACAAGATGCTGCGTGTGAGCAGCCGTTCGGAGCTATGGCTGG
GCGAGTACAAGCATGAGGTTGTGCTTGTCAAGAAAATCAAGAGCAACACGGCATCAAAGGCGTTGATGCGGGACTTCGTGACAGAGATCGAGCTGATGTT
CGAGCTGAAACACCCTCGCATTGCAGCCTTCCGGGGTGCTATGTGGGATGCGGACGGCACGGAGCTCTGCGCTGTGGTCGAGTATGTTGAAAAGGGAGCG
CTGCGTGATTGCACGGTTAACAATGCCATGGAGCTGTCGGTGCCAAAGCAGCATACCATTGCTCGCCAGATTTCAGAGGCCATGGCTTTCCTTCACAAGC
AGAACATTGTGCACGGCCGGCTGAATGCGTTCAACATCCTTTTGGACAAGGAATATTCCGCCAAGCTTAGTCTGTTCAGCATTTTCCACTACGTGAAGCT
TTCGCCTTTAGACAACGAGTGCAAGATCTTTGCCGCCCCAGAAGTTCTGCGCGGTGAACAACCAACTGAGAGATCTGATGTATACGCATTCGGCGTAGTG
CTCGTGGAAATCGACACAGGTGAGACCCCAGTGATGAATGCTCGGAGGCTATCGATGGAGCGATCGGGTCGCGAGGATGCTCTCTCTCCAACCGCCAAGA
AGACTGGATTCCGCTTGAGCCGCCTCTGCTCCGGCGTGATGAAGGAGATTATTGCAGCCTGTCTGGAAAAGGACCCTGCACGACGTCCATCAATGGCTGA
CGTGGCATTGGCTCTTAAGACTGGAGCGATGAAGCTGTGAGGACTCGCTCAGCAACGAAGGCAGGCTCGACACAAGCCACTCTGGATTTTATTTTCTACT
ACATGTACCGGTACTAGCCTGGACAACACGCCAATAGCGTAAAACGCTGCTGCATGAAGCAGAACTCGCGGTAGATGTAAGCCCGAACTCATGTAAATGG
GAGGCAGCCTCCCTTATTTTTACCCGTCAGGAAGCACAAGAAGAGCACTAGCCAGTTGTCGCTCTTTGTATAAAAACCACATAAAAACATTTAGGAAGCT
GGTGGTTTTTGCTGTCACGGGGACAAAGCGAACAAGGTGAGTGTACGACAGCATCAAATTGGGAGCAACCAATGTTATGACTCATCTGATTGTCCAAACA
TATTGAAAGAATTCTCATGCCTGTCAAGTTGACAATCAAGTCAACCAGTCGATTCAGCCCTGGAGTCAAAGCCAGCGATGAATGGCATCCTTCGCTGGCG
CCGCATCTGTTCCCGTGTTTCCAAGACACCGAAAAGCTTTCTCCCCGTCGTTTCGGGGGGTCGTGCTATTCATGTATGTACACGTCATTTCGATTTCCTC
GCTAATCACATGCAAACACGTTAGCAGACATTGCCGTGCCTCAAGCGATAATGCAACCAGTAGCACATTGCATGAAAAAATTGGATTGCCTTTTTCTACA
AGCTCGAAGTGCGCCAAAGCTATCATTGTGCCAATAAATATTCAACGCGCCTCCCTACTCCTACTCCTCCAATTCGCCCACACAAAACGCAATCCAATGT
GCGTGGAGCTGGTAGAAGTCTCCTATGATTTCCTATGTGCGCGCTCGGGTATGAGCGGCAATCACCATCATCGTTTCACAGATTTGGGCAAAGCGCCAGT
GCTGGTGGCTTGATGCAAAGAGCACACATTACCATTGCGCTCGTAAGCAGGCTTGCGGCAGCCTTCCACAACACATCGCTTGCCTGTAAGAAAACAAGTG
AGAAAGAGCAAAAATAAGCAGCAGCACGCAAAAGCAACACAGCGAAAAGAGAGCTCTGTGCGTGAGTATAACACGATCAAGAACAAATTGCTTGAGTCAA
AGTAGTCATGCAGCTCACCTCCTCCGTGAGCCCAGCAAAGACCGTGGGAGACTGCCGTCTTGGTACAGTTTTGTTCGCTGCATTTGCGACCTGAAAAGGA
AGCGGAATTCAAGTGAGTTTTGCATGACCTGTACGAATGAAAGGTAATCAATCAGCACTGCACCTCCGCCGTGAGACCAGCAGACGCCGCGAGACTTGGC
ACGGTTCTCGCACCCCGCCACGGTGCATTTCGTCGAGCCGCCTGCAATTGTTGCGCAAGGTTTGGTAAGCAAATCATGAAGCCACCTTTTTCAATAATCG
TGCTTGCCTTACCGTGCTTCCAACACACACCCAAATTTTTAGCACTGCTCGTGCACCCCACGACTGCACATCGCTTACCGCCCTGTTATCAAATCAAGCA
TTCGGTCAACATTGGATCCAATGCGAACAGCGAAACACCGCACAACTGCCACCCACCCCGTGACCGATGCAGAGTCCGCGGTTCACCACGTAGCGCGTGC
AGTTTTCAAACTTGCAGATCCGCGACTTCTTGATCGCAGCTTTGGCTGCTGCGGGCGCCGGCACATTGGCCTCTCGGTTCTCCGTCGCCGATTCGTCCCG
AGGGGCCCCTGAACTAACCGCGAGGTCCGCTGCAACGCACCAATGCAGCAAACACCGACAAGTCACGCTCTGCAAATCCAGTCGGTCGTCCGCAAGGTTG
CAAGGATCAGCGCAACGTACCGAAGCTCGACGTTTGGTCCTCGTCCGAGCCGCCGAGGATGAAGGCGAGCGAGCTCTTGCTGGCCGCGGCCGTCGCGTCC
GTGTTCATGATGGCCTCGAGGCGGTGGCGGTTGGCGGCGACCTGGAGCTGCTGCAGCGCCGGCAGCGAGGGCCCTTCTCGCACGCCGTGCCCATCCTGGC
GGGGCTCGTTGGTCGCCACTTGGTGGAGCCACGCTGCGCTCATGTCGACGTCGTCGCCGGCCGAGTTCTTCATGCAGGAGGCCGGATACAGCAGCATCCA
GAGGGGGCAAAGTCTTGAGATAGGGACCAAAGGGGTGTGGTGGTATTTTATTCTAGTGCTGCCTGCTGCTGGCAGAGTCAACTGTTCCAGCAGTCAGCCG
GTTGTTATCTGAATAATGGACTGCAAGAAGCAGTCGATTCAAGTCGACGCCTGCCCCGGCTGGCGAGAGAAAAGCCCCGAGCGCGGGCCGATGGTGCGTT
GATTGCTGTGGCCGCGTCACTGGAGACTCGAACCACTGGTGTCCGACAGGCTCCGCTATTGATGCCGGCTCCGGCTTGCGAGCACTTGCCCTTTGTATGT
CGCGCGGCGAGGCCAACGGATGGTGGCCAAAATTGGCCCCATTTCGACCAATCCAAAGTGGGTACACAGCGCCGCTTCGAGCTTCGAAATCCCGCCCCAT
ACTGGGGCCAAGCTGTTTTCTCCCAAGATCGCGCGGCTCGTCTCT