Description :
From Genome Similarity Track
Location :
Scaffold_482:16355- 18521
Transcript NameFunction/comments
g9075.t1hypothetical protein
g9076.t1hypothetical protein

Sequence
2166 bases(100 bases per row)
GCTGGCCAAACACCTTCGTGCTCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAAAGCAGATCGCATTGTCGTG
ACGGATGATCATGAGTTGAAACTCAAGATCACGTACGAGTATCACTATGCCCCGACCTCGGGACATCCTGGCCGTGAGAAGACATACTTGCTTCACATGC
GTGACTTCTATTGGAATCACCAGTACAAATGGGTACGCAAGTACGTTCGTGCTTGTGAGGTATGCCAGCACGTGAAGCCTGCGCCCTCCGCTTCAATCAC
TACCGACTCCGTCGGAGTGCTGGCAATCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGGTATAGTGGTCTTTGTTGA
CCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCAGAGGTGACAGCCAAACAGACGGCATGCCTGTTTGTCGACATGGTGTTTAGACACCATGGT
ATGCCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCACGATTCTGGCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTCGACTG
CGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTGCTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTG
CTTGCCGATGGTGGAGTTCGCCATCAACAACTCGGTGCATGTCTCGACAGGACACACACCATTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGC
GTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGATATCCGGTTAAATCAAAACAACCCGATAAGCACGCTGATACAAGCAATTTATCAGCTGTGA
CGACTCGCGCACGTACTGCGCGCAGTCATGGCGACGACAACACAGTGTCTACGACGGGCGTAGACACTTTAATCAACAACGAACAACACGCGCAGGTCGG
GCCTGCTGCGAACAAGAAGCACGAACTGAACCAGGGGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGCCGACAAGCCGTAATTCGGTTTGTCCAGGAC
GCGATAGCAGCTTCTGTCGATCGACAGAAGCTGAACACCGACAACACCGGCAGGGGAAACACAAATGAATTCAAAGTTGGTTCATTAGTTCTGTTAGCTA
CGCAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCAAGCAAGCTTTCTCCGTGCTTCATTGGGCCATTCACCGTGTTGGCGAAGCATGGAAACGC
GTACACACTGGACATACCGTCCAGCATGCGCTTGCACCCAACGTTTTACGTTGGGTGACTGAAGCCGTACGTGCAGCACGAGTCACCTACGTCTGGTGAC
TCGCCAAAGCGCTCTCGAGCGCGGCGACGCGCTTGAAGGCGGCTGAGAGCCTCGTCCCGACCTCGACCTTTACGTCTGAGGTCGTCTGCGCAAGCTCAGC
TCCTGACGCAGAGCAGCGAACTGCGACTCTTGGAGACGCTCAACAGCCTCCAAGCGAGACTCAAAGTTTGGTTGACCAAACCCGGGGCGTCTTCCCGCCC
CCCCACCCCCGTTGCGAGACGCACGCGGGGCAACTCGCTGGCTCGTCCAGCGAATTGTTGGTCATCGGAACCAGACCCGAGGTCCGGTTCATTTTCGTAT
TCGTTGGAGAGGATTTCCTCCCCAACACGATACGTGGGAATCACAGAATGCCCTGATGGAGGACATTCCCCGAAATGGTGACGGCGTACGAAGGCCGCCA
CCTCCGCCGAAGGGCGTAAAACTTGGGCGAGCGCTGTAGTCGCCTACAGCACTCGAATAAGTGCTGCGATTATCCGCAGCACTAGAAGACGCCTGCGCCT
GAAAACTGGCGCGCAGGGTCTTGAGGTCGTCAGGTACACACATGGATGTGTACCCGTTAATGTCCCGCTCGGTGATGCGTACTGCTCCGGGGTAGCAGTA
CTCACAAGCAGTGTCGTAAGTCACTGCGCAAGGAAGTCCGATACCGACTGCACCATGGTGCAGTCGTTCAAGTTTACCACGCTTCGAGAACTTCTCGTAG
CGCTCCCGCGCCTGGCTAATCCGGTCACGATAGCCAGCGGGGTTCTTGTTGAAGTTTTCAACAAAG