Description :
From Genome Similarity Track
Location :
Scaffold_4:1635025- 1646157
Transcript NameFunction/comments
Phyin_T30-4PITG_03408Putative uncharacterized protein
Phyin_T30-4PITG_03409Serine protease family S10%2C putative
Phyin_T30-4PITG_03410Acetolactate synthase small subunit%2C putative
Phyin_T30-4PITG_03411Lysosomal beta glucosidase%2C putative

Sequence
11132 bases(100 bases per row)
TACTTCCGCGGTATGTGCGGCTTCTTTACAGCAGGTTGAAACTGCGATCGCAGTTGGAACCTCGCGGATTTTGTCCAATTGACGGCGACCCGAGCGAGAA
GAACGCAGACGATACCCAACACAAGATAAACAGTTGAGCCCAGCCATCCACCACACGCCTCACTCGCGGCTCACCACAGTGAACCCCACCCTTCGCCCTT
GTCCAGTCTCACAGACCCCGCAAGGTGTGTGCCCGCCCGCAGGATGCAGCAGCGCCGACAGACCGAGGACGCGAGCGGAAGCGGTGGGATGCCGCGACGT
TCGCTGATGATGCCGTTCCTGGCCCAGCCAGGAGACCCCTTTCATCAGACGCCACATCCACAGCCGCAGGCGGCAAGCTTTCCGCAGTACCCGCTCCCGA
TGGAGCCCTCTATGCGGAGCTACCAGCACCAGCAGCTGACGCAGCAGATGCCACCAGAGAGACACTACTGGCAGCCTCCAACAGGGATGGACGCGTCGAG
CTACGCAAAACAGAGACGCCACGGTGACAGCATGGACTTGGGGGAGTTTGGAGGCATGCTGGACCCCGACACCGCCCCGGGAGTCAACGAAAGCGCGACG
TCCGGCCGAACACCGTCTGACGCAGTGTCCGAGATAAGCGTGGCGAGTTTTGACGTGAACTCACTCCACGACAGCATGACTGGGTCAGCTAGTGCCTCAA
CTGAGGACACAGGCGGGTTCCAGCCGCCTGTAACGACGACCTCGATGCATTCTGGGCCACCAACTACGCCACCAAAGCCAAAGCAGGCTCGTTTAACGAC
GAACAGGAAGTCAACAGCAAGCACTCGACCTTCGTCCGATGTAGCCACCAAAGCTCTGGTAGACGCCGCGTACGCACAATTGAACGAGTCTAGTGTACTC
GATTTGAAGGCTGACGAACTCTCCAAAGACAGAAGTGAGAGGTGCCAGTTTCCCGACTGTCCGAATCGGGCACGGGTGTCTCAGTCGTACGGAAAATTCT
GCAATCGACACGTGATTGTTGCACCCTGTGGCTTTCCTGGTTGTCGGGACAAAGCGATGGATAGAGCTGCGATGTGCGCTAAGCACTTGGAACAGGGCAA
GGAGGCACTACAGGAGATCTTGAAAGCACGCTCGCAGAACGTGCCTGTATGCAAAACATCCGGGTGCTTTAAGAACGATCAAGGGCGTGGTTACTGCCGT
GGTCATGAGAAATTGCTGATGGCTACTGGACGCCTACCTCCGCACGTCAACAAGCGCCGCCTCAACAGTGCGTACACCATGTGCAGCTACCCAGACTGTC
CCAAGCATTCTCAGCGAAATCACTTGTGCCGCACGCATGGGAATCTTATCATAAAGCAAGCTCAAGAGTTGGCAGATCGACCGGGAGCCACTGAAAGCTA
CGAGGAAGTTTTAGCCAGAATGCAGAAAGAAATACGTCGCTGCACACACGAAAATTGCTCGAAAAATTCCCAGCGAGACCGACTGTGCACGACGCATTAT
TTCGAGAAACATCATCTGCAAAAGGAATCGTCAACGTCGGCTTCATCAACGAAACGAAAAGCCGATTCAGGTAAACCAAAAAGGGCGAAAAGTAAAAACG
ACAGTGATGTTCGAGCTGTTAAGGACACTGGCTGCGGAAAGCCCGGCTGTGGGAATCTATCGTATTCTGCAGGATTGTGTGTGGAACATACCAGGGAACT
CCAGAATCTGAGTCAGAACCAAAATCGCTATGGAGATCCGTTCCCGTCTGGAGAGAGTAGTGGCATCTTTTCGGGTGACGTGGATAGTGAAGCAAAGCCG
GGAGTATTTGGTTTGAACGAAAAGCCTCTAGCTGTTGATGCCCCCCAACCATCGGATATGTCATCGACGGTAAGCATTAGTCACTCAGGAAAGTGCTCGA
ATCCTATTTGTGACCGAGAAAGCTTTGGCCGGGATTTCTGTGAGGCGTGTCAGCGATTTTTCTCACCGCAGGGATCGATAAATACCAGCTCTTCTGGATA
CCCGCTTACTCCTACGAATGTTGGCGTCGGTCAACCTGAAGAAAAGGCTTTACTGTGTCGAGTGAACAGTTGTGGTCAAGACTCTGCGCGTGGTGGATTG
TGCTCAACGCATCTTCGAGCCTTCAGAACAGGGTCGTTATCTGTGGATAATTTGAAATTGGATTCCCAGGCGCAACAACTGCAACATGAACAGGAGTTGG
CAGAAGCAGCAGCAGTCGCTGCAGCAGCAGCCGATGCTAAACACGCAAGCCCACCTACCTCTGGTAAAGCCCGAAAGTATTACTGCAGAGCTGATGGGTG
CGGCAAGCAGGCTCATAGACAAAATCTGTGCAAGCGTCACTATCGTCTGCAAGAGGGAATTTCTGCTGGCAAGTTGCAGCCCGATGCTTCATCGGGTGGC
CCGTTGAGCAACTACATGCCAGGCGTACAGCAGATGGGGTTTGAGCAGCCAACTATCAGTTGCCAATTCCCAAGTTGCTCACAAATCGCGTGTGGTGGAA
CTATGTTGTGCTTGGCCCACTCTAAAGCCACTTTTTGTTGGCAACCAGGATGCGAAAATCTGGTGGGGTATCAACAGTTCTGCGAGTTCCACGCGTTTCG
TCAGCAATGTGCATTCGAAGGTTGCATGTACAGTGCTGAGTCAAATTACAGTGGCTGTGCGAACCACATGGTGGCTCGAAAATGTCGCCACGACTTCTGC
GATAAGTTTGCTGTGGGGTCAGACAGCGACTGGTGCCGCTTGCACCAGATAAGTTGCCAAAATGCTCCCTGTGTGCTATGCAAGTTGCATGCGCTACCTC
TGAGTAGGTTTGCGCCAATTGAGAATGAGAACACCAATCGAAGTCGATACAACGCGAATCTGAGTACCTCGACATCTAAAGGGTTGATGAGTGGAGGCGG
AGGGAATCTATTTGGCCGGAACCCACGGCTGATGTAGACCCGGATGACTGTTGTTGCCGTCTCTTAGCAATTGGAAATGGATACTGTAGTACTTAAGGAA
AATCTCTCGTGACAAGGATCTCTCTTGAAGCTAGAGACAGAATCTGCTGAGGTGGCTTCGTGTGTAGTCGAAAGTAGGGGTTTGGAGAAAATATAAATGT
GTTTTCAGTCAAGTCCACGATGCCAATTCACATGACGTGAGCCACGTCACTTTTCTTTTTGTTTTGTCCAGGATCCATCTGAGATTTGCAACCAAAGCTT
GGACTCAACCAACAATATTTCAGCCTACCGGTATTATAAGATAAATACCGGTACTATTAGGTTTTCAAACCTTCCCCAGCTTCAAGCTCGTCACCAGTCG
ACGCAGTCATCGTCTCGCTGCTGCGATGGAGCGCATCTATTCGGCCTTCTTTACATTGGAGCGGCGCCGTGAGTCGCCGAAACTCACGGCCGCGGTACTC
GAGCTACACAACGAAACGCAGAAGTCGCAGAGACAGCCGCCATTTATGCGTCCTGGAGGTGACGGCGTTAGTCGACGCCCTGATACTGAGAACGAATCAC
TCCATGAGGCCAAACGACATGCATCTGCGAGACGGCAGGATATGCAAAATATGGTGATGAGCTGGACTAGCGTCAAGAAAGATCTAGAGGCGGCGTGTCA
AGCGGCGGCCAGAGCTTTCCTGCTCGCCTATGGAGCCAAAGCCTTCACTGCCGTACTACTAGCCTCGAGGAAATGGAGCAGTCTAGAGTACGGCTATGCC
GATGCGGCCAGATTGCTATTAAAGGGAGACACGCTTCGCTTCGGGGCCTTCTTCGGCAGCTTGGTGGGGATTTTTCGAGTCACTGAACTCGCGGCACGAG
CAGCTCGAGGCGGTGAAAGAGATGCCGTCAATTTGGCTATTGCTGGCGCGGTGTCCGGTTCAGCCTTACTGTTGGATTCACCGTCGAGACGCAGCACCAT
TTCGCTGTACATTTTTGTGCGCATGTTGGACGTGGTATGTCGCCATTTGATGTCAATCAGCGTCTTACCGACGTGGCGATACTCGTCGGAAATGCTCTTC
GCCTTGAGCAATTCTGCCATTATGTATGCATTTGTGGTGGATCCAAGTTTGTTGCCGAAGGTATGTGGAATGCCTTAGTACCGTAAATACCGGTAGTTGC
CGCAAAAAAGGTTGCTTGATTCTGACTCTTCGCTACTACACAATGCACTTTGGCCAGGGTTATTACCATTGGATTTGTCGAATTGGTGCCGTGAACCATC
ACGGGCTGGAATACACCATTCGTCAACGCATGCGTGGCCAGCTTGACACTCATGGAAACCCGCTTCCATTCCGCCTGTGCCAACCACACTACCACATGTA
CGCCACAATGTTGTCAAGGATACTGAGCTGGAAGTTTCTGATCTTTCGTCTGATTAGGGAGTCGTGCGTGACGCACGCCATCAAAGAATGGATTAATGGC
TTGGGGAGGTCGATGCAAATCTACCTTCCTGTACATTTCCTTCCGGCGATCTTCTTTCGCTTCCAGCAGTTACACGGATCGCCATTGTCTACAACTGCGC
GAATCTCCTACGCAGCGCTTTGCTCTTCGGCATTTCTGACGTCGTATCAGGTTCGAGTGCTGTGTGACTGACTTACAAATATCGCCAACAGAGAGCTAAC
TTTCTTGACTGTTTAGACGGCGGTTAAACTTGTCGTTTGCACCGCCCGCAATGCTTTCCATCGAGATCTTGCCGCAACATCGCTGGCTGCTGGTGTACGT
ATACTTCTGATTCGTGTTTGACGTCTTTCTATAATGACGTTAACGTGGCTTGCGCATGTTGTTAATAGGTCGCATCTGGCGGAGCACTGTTCTTCGAGCA
TACCAAGCGCCGCTTTGAGCTCATGTTGTATTGCTTCCCACGCGCACTCGATATCGTGTGGCAACTTATTAAACGCCGCGGTCTTGTACGCTACGTGAAA
CACAGTGAGGTAGTTCTATTCTGCCTCTCCATGTCGCTCATCATGTCAAGCCCGGCACGTTACTTCAAGCCGACTTACCTCCGAATCTTGCGATTCATTT
TTGGCGGCGATATTATTTGAGAATTCCGTTTTTCATTGCAAGAAATTGCACGATAAGAAATGCAAAAATTCACACCGAAACGAAAATGGCAACAGATAAA
ATCCGACTGACAAAACGTATGGTATTCACAACATCCGACTTCTTTTGCACGTGCTTGGCACTCACTTTTGCCAAAGCTTACTTTAAGTCGTTGAGCACAA
ACAAATCAAGCATTTGCTTGGCCTCCTCAGGCTGCCCCATCGGCACGAGGTGGCCCGCTCCCTTTACAGTCACATACGAGATCCCCTTGAACGCTTCCAC
AAAGCCGCCCGTTTGCTTTGAGTCTCCCTCCTCGTAAGTCCAGATCGAGCGCGGTGCCAGACGGGGAAGACCTAGCGACTCCACCGCCCAGAGTCCCCCC
AGAGCGTTGCAAACCAAGTCAGAATCACCGTGATAGATTACCCCCTTTACTCCACGCTCAAGTAGCCGGCGCCACAAGGGAGTCACTTCACCTTGAAGTG
AAGATGTGTATTTCAACATCTGTGGGTGCTGCAGGATCGGGTGATCAACACCAAGAATTGTACTCAGCATATCCATGGCGGAAGCGGTGAGTGCACTAGC
ACTCCAATGTTCCAGCATTGGGTTGGCGTGCATCGAGTCGCGGACCTCAGCCAAGTTAAAGTACGCGTCCAGACGCTTATTGTCCAGACACAAGTCCATT
GTGTTTCCAATGGGGTGTGGCAGCTTGCCAGGAATTGATGGCGTCAATAGCTCCTTCACGAGACGCTGAATATCCTCCTTCGGCGATCCAGCACACGACC
CGTATACGTCGTACATATTGATGCGGTCATAGACCAACGTTGTCATGATGTCCATGGTAGCGGAAGTGCACTCCGAGCTAGCTTTACCGATACCAGGAGC
GGCAAGGGGGGCCTTTTCGAATTCGTGGAGATCGGGGCAGCTAGTCTGGAACTTTTGGTACATCTCTGTGCTCAACAAGCCATGGTAGTACGCGAACATA
ACTGTCGAGAGTCCCATGTACTCGTTCACGCCGTTGCCCACCACGAACTTCTTCAGGTTAATATGTTGGGACTGATCCGATGTCGCCGCATTACCGTTCA
GAATGGCAAGTGCTGTGGTCGGCACGTAGATTCCTCCATAGCTCTCTCCAGAGACGACAAAGTCGTTCTCCCTGAGCCAAGGGAATTTCCCGAAGAACTT
CTGCAGCCCGTCATACAGATCCTGAGCCTGAGAGAGATCATCTGCTTCGTACACTCCACTGGAATTGTAGCTAAAGCCAACGCCTACGGGTGACTCGATG
CACAGCAGATTGGACTTCTGGTTCCACGCAAACTTGTTCACCCTAAGCGTCTTCCCGTCCTCATTAACTAGCAGCGGTCCGTTTTCCGAGAAACAACCCA
TAAGGGAGCTTGATCCCGGCCCTCCATTGAGCCAGAGCAGCACGGGGTCCGCCTGGGCCGTCGAGCTCTGAGACTCGGCAAGGAAGTAGAATGCGTGACC
TCCGTTGTTCAACGGCAAATATCCCGAGAAGAGTCGGGACGTATATTCAGTGGGCTTTCCGGCAAGCGTCAGAATTTCGTCCGTGAAGCCAGGGAAAGGC
TCGTTGGGCTGCAGGGGTGCTTCGGCATCGGCCGAGTCTTCCATGACTGTGGGCTCAACCCTGTGCGCGCCTGTACGATTAAGGTTTTCCGTCTGCAGGG
AGCGCTGTAGCGTCACCATCAGGTCCCCCACGGCCAGGAAAAGGAGGCAGGCAACGCCGTAACGGATAAAGCGCCGTGCCGCAGGCGACAGCAGACGCTG
TGTGCGTCCTGTAGTCGATTGCGTTTGATGGGACCGCAGCCCGCGAGTTAGCGGCAGCGTCTCATTTAGTGGGTCCGAGCGCAGGTACATCTTTAGAAAT
CAGGCAATAGAGTTGCGTGTGTCTAGCTTGGTAACTTCAGTAATGCTTTCATGGAAGCTCGAACGAAATGCTTGATTGACTAAGCAAATTACTTGAAGAG
GAATGTAGGTCATGATTGCAATTACTGTTGCTGTAAAGGAAAGGGAACAGTGAACACTAATCAAATCTTTAGTACTTTAGTAAGCCTCAAAGAAAATATA
TTAATACCACTACGGGTAAACGTCCTCATGTATTGCAGTCTGGACTGTCCAGAGCAAAGAATGTGTTAAGCTTACAGAATTACTTTGTGAATACAATTGT
CCAGTCCAGCGCAAAGATGATCACATGTGACGTGAAATTTTTCTCACCAGGTACTGTAAAGTACAGTACTGCACCCCGTTTACCTTGTACTTCGTATGTA
CATAGGACTGTATCGACTTTATTTCATTGAAATGATCACAGAAACAGCGAGCACCATAATTCTTCTGAAGGCACTTTGATTTGATTACGAGTAGTTGATC
ATCTCATAGAGACAATCTTCGCTAGCACGTTCCTTGCTGCAATTGTCATCAGGCACAAGTCCTATCGAAGAAAAAGGTGATGGCATGATCATAACTCTAC
CAACATATTATCCAGGCGGAAGGCGAGAGACATCGAACTCTTCGTCATCGGCCTCGTCCAGAAGCGTTCGCGTGGCGCCCTCAAACGTCGAGAGATCGCC
CAGGTCGTCGGTCACACTGGTGCTGCGAGCCATCGCAATGACCCCACTGCGGTGGATCTCTGTGATACCCAGCGGCTTTAGCAGGTCCAAAAATGCCTCA
ATGCGACCAGGGGTGCCAGCCAGTTGTACCATAACCTGGTGCGGTCGCACGTCAATCACCTTGGCGTCGAACAGGTTGGCAAGCTCCACCACCTCAGCGC
GAGATCCAGCCTCTGTAGCCAGCACACACACCAGCAAATGTTTACGTCAGGTCCATGTTCACGAATTCCGGTGGTGGTAGGGTATCAGATCAGCGTCCGA
CGTACCGGCCGTGGACACCTTGGCCAGCATCAGGTCGCGCTCGACGTAGTTCTTTTCAGCGTTCTTGCCACTGCTCAGGATATTGACCACAGCAACATAC
ACGACATCCTCGAGCTGCTTCTTCATCTGCAAAGACACATTGAGTGTCAATCACCTACTGCTCCTGTCTCTGTAATTACTATACGTACGTTGACAACACT
CTGCGCAGTGCCGTTGACGACAACCGTCATACGGGAGAGCTCCTCGACCTCCGTGCGACCCACAACCAGACTGTCAATATTGTAGCCTGCATCACACCAT
GTTTAGGATCTCCTGTGGCCAGCGTCTTTGCGTATCGATAGTTACCTCGAGCGGCGAAGAGGTTGGCGATCTCGGCCAGACAACCAGGCTGGTTGACAAC
CAGCGCGGCGATCACATGCCGCTGACTCTGCTCCGCAACGCTGAAGGCACGTGAAAAGTACTTGGGAGCAGCACAGGACGGCGCTAGGCTAGCCGCGGAC
CGCGGGAAGGCACGACGTGCCAACGGCAGCACAGACCTCCGCAGCATCTTGACGAAACTCGAATGTGGCGTCTGAAGCTCAGATCAACAAGCTCTGCAAA
ATTTGCGCAAACAGCTTAAAACTCGTTTAAGTACGATTGAAACAAGTATCAGGTTGCTCAGAAAATGAACGTGGATCTGGTGCTAGGGCTGCTATGCTGG
GCGTGCAGCAGCGCATCTCGGCTCGCTCTCGCTGCTGTTGCATCGCCTGCTGCTCATGAGCTTGTGTACGATCCGAATACCGCCGCCTTCAATGAATTTC
GGAGCTCAGTAGAGCCCTCAGCCACCTCGAATGGTTTCGATATCGGCGCTTTGCTGGCTAACATGACGATCCACCAAAAGGCGGCGCAGATGACACAGAT
GGACATTTACTCCATGATGGACGGGGATGAGAGAGACCCGAAGAAAGCTCTAAAGCGGGAGGTAGTGGCTCAGTATGCGCGTATGGGTGTTGGTTCGATC
CTCAACAGCCCATTCGCAGGTGGGCCTGTGGGTGGACGAACGGGCTGGAGCGCGAGCGAATGGCGGGAGGTGATCCACCAGATCCACCAGGTCTATAAGG
AGGAGGGCGCTGCCGTACCAATGCTGTATGGCGTGGACACTATTCATGGCGCCACCTACGTGCAGGGGGCTACGTTATTTGGTCAGCCTATCAGTGCTGC
TGCCTCGTTCAACCCCGGGCTGGTGTACAAAATGGGTGCTGTTGCTGCCAAGGACACACTGAGTGCTGGTATCCCATGGATCTTCAGTCCGGTGCTGGGT
ATTGCGGTGCAACCGAAGTGGTCTCGGGTATACGAGACCTTCGGAGAAGATCCTTTGGTGTCGTCCGTCATGGGAGCATCTCTAATTAAAGGATTACAAA
GTTCGGGCAAAGTGGCAGCTTGCATGAAGCACTTTATAGGCTACTCGAACGTTCGCGAAGGCCTTGATCGTGCGGACAATGTCATTTCGGACTGGGAACT
TGTTAACTACTACACACCGTCGTTCCTCGCGGCGGTCCGCGCTGGAGTTCGTACCGCAATGGAGAGCTATGTGTCGGTGAATGGCGTTCCCGTGATTGCC
AGTAAGAAGCTGCTGATTGATTTGTTACGGCACGATATGAACTTCACGGGATTATTGGTGTCGGACTACAGTGAGGTGGATCGTATGTATTCGGAACACC
ATTTAGTGCCCAGTGTGGCTGATGCTGTTCGTGTTGCCCTGCAAGAAACGTCTCTCGATATGAACATGTCACCTAACTTACCTGCATTCGGTGACACTAT
CGAGTCGCTAGTCGAGCAAGGACTCATTTCAGAGAGCCGTCTTGACGAATCTGTGCGGCGCATCTTGGAAACCAAACGGGATCTCGGACTGCTCGAGCCA
GACTATTACGATAGCTTTGGGCGTGACGGAATGGATAGTGCGTCTACCGTTGGCGATGCTGCTGATCAACAGGCCGCGTTATCGTTGGCCCAGGAGTCAG
TAATTTTACTGGAGAACCACAACAGCGCTCTGCCTATTGACCTGACAGAAACGACAAATATTTTTGTCACCGGACCTGTGTCGGACAACAAGGGCTTTCA
ATGTGGTGGATGGTCCGTGTTCTGGCAGGGATCCAGTGACTCGACGCTTTTCCCGAATGGTGCTACCTTCAAGAAAGCCGTTCAGGCCAAGGCAGCGTCC
TCGGGCGGGCAATCGAAGCTACATCATCTCGAGGTGGTTGATATTGATGGCAATGTGAACCCTCAGGACTTTCAACGAGGAATGCAGCTTGCCGCCAAAA
GCGAGTACACCCTGGTTGTATTGGGTGAGCCAAACTATGCGGAGAAGACTGGCGACTTGCTAGGAAGTATGGCTTTACCTGCTGGACAGTTGTGGTACCT
TGAGGAGCTTACAAAGCTGAATTCGACCAAGGTGATTGTCGTGCTCGTTTCTGGTCGTCCTCGTTTGCTCGAGGGGGCCCACAACCATGCTGACGCTGTT
ATCCTGAGCATGCTGCCATGCGAGCAGGGTGGCCAGGCACTGGCGGACGTGATTTTTGGGGTTGTGAATCCGTCAGCGCGATTGCCTATTACCTACCCAG
CGCGAAGTACCCAGTTATAACCGTATTTTCACCGTGTCAACACGCGATGTCAACCGTTCGACGAGTGTCCTGTGCAGTGGCAATTTGGTCACGGACTCAG
CTACTCGAAATTCGAGTACTCGACATTACGACTTAATGCCACTCAGGTTCACGCTACAACGGGAGCGCTGAAAGTAGCAGTCACCGTGACGAATCGCGGT
ACTCGCTCGGGCAAGGAGGTCGTGCTGCTGTTTGTATCCCAGAAGTTCCGACGCGTATCTGTGCCCGAAACGAAGCTACTCAAGGCATTCGAGAAACTGG
ACGAGCTGGCACCGGGGGCCAGCCAAGATGTCGAATTCGTACTCACACCTGAGGATTGGAGCTATTACGAGCCGCACATGGTGGGTCATGGCTTTCAGTG
GCGAGCTGAGCCCGGTGAGTTTGTTGTCTCTATGCTACCCTCTTCAACGGACACCTCGACAATGGCAGCACCACGTTCACTGGACGACAGTGATGAAAGG
AGCAGCCAGATGAAAACCCGTGGCGGCCCGGGCTTCTTGACATCAAACACTTCGGAATGGCCAAGTTTAGCGTCAGAGGCTGCCTCGCGTAGGGCCTCGG
GACTGAGCGCTTCATTCCATGTGATTCCCTAG