Description :
From Genome Similarity Track
Location :
Scaffold_365:1635- 8440
Sequence
6805 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATAGTAGTTGTGTTTTCGGCTAATAATATTACTATTTGATACTAGAGGCATATTGGCTAACGCAGGGAC
ACATGTTGGCGCTCGGTCGGTTCAATAGAGAAAACGGATTCGCTGCTGGGAGGCTCGCGCGTTCGGCGGTCGCGGTTCGTCGCACGGGGCCGGTCTACTA
GCTCAGGGTAGAACTCCACGCCTCCCAGTACTTCGGCATACGGTTTGTACAACGACGAAAAGTCAAAGCAACCCTTCTTCTCAGGCTGACAGCGACGGCG
GCGCCTAGTGTGACGGGGCACACAGCACTTCTTAACAGAGGAAGCAGGAGTATACAAACTCCAAGTGAACAGCCGTTCACGTGTCCCTGGTCTGAAGGGG
ACGACTTGACTTGAAAAGCGGTAGATCTAAGACGGAATGTATTTATAGGCTGGTACAGATTTGGCCTGCATACAAATCCTAAGTTCCCTTAGTTTGTGTC
ATACAAAATGTATCTATTGGCTCTGAGGCCACTTGGGTCACTATCCAGGGGAGTGATCGATGTAGCCATCCCGGAATAGTGACAGGGTCACTATTCCATG
TAACCCCATTACATCCTCCCCCACTTAGATTCGATCTTATCGACCAATCAGAGCGAGGTTACGCCGGCGACTCACATTTCACTCGCAAAGTCGAAATCCA
TCGACAACGGCGCGAGCTCTGGCGCCTCGGCTCCCGGGCCTCACAGAGCAACTGGCGCATCGCCGAGCAAGCCGCAGGGTCTCCACGTTGACCGGAAGCA
TGCCTCCAAAGCGCAGTGCGCGCAGTGCGAAAGCACCTCCGAAACCGCGGGCCGTAGGGCCGAAGACCAGGGCGGCCAAGGCCAAGGACGAGTCGTCCGC
GCTGATGGAGGCCACGAAGGCGGCCGAAGAGGTGGTGCGCTCTCGTAGCAGCACGCCGGAGAGTGGTCGTCAGGCCGGGGCTCGGAGCAAGTCTCCTGAC
GCCGCACAAGGCAAGGAGGAGAGTCCTCGGGGCCATAAAAACCCGGCTCGCGACTGGGAAGCCGCCGTCTTTGACTGCACGATGGTCCAGTACTCCGGTG
AGAGTTCACCCGACGACGAGAACGTCTCGGAGGGCAGCACACACGCTGCCGAAGGCACGGAGCTGGCGGCAGGCGACATGACCAACGCCTCGGCCGACGC
AAAGGCCTCGTCAGAGAAGGAGGCGGAGGACGCCGAGTCCGGCTCAGGCGACAGCAAGCAGTCGCACGACGAAGTCGCCATGGCCGACGCTGGGGTCGTG
GCCGAGAAGTCGCCGAGCGATGCGGGCTCCAAGCCCAAGGAGGTGCTGGCATCCAGGCATCTGACGCTGGCACAAGGTCATGAGCGTGCCCAAGCATCGA
AAGCGGCTGCCCATGCGAAGGCCGCCGAGGCCAAGGCGAAGAAGCGTTCAGCTTCCAGGTCGCCTCGCGGCTCCAGCTCCAAGCTGTTCATCGACTCGGA
GTCTGAGGACGAGGAGGGTGCCGTCCACGAGCCCAAGGAGCTCTCCAACAACCTCGACGAGCAGCAGCAGCAATACCACGCTGCTAGCTCGGGTGCGTAT
GCCAGGCAGCCGACTGCCAGGACTGCCATCGAGTCTTCTTTAGGCGGGGATGCCACGTACCCGCAGGGCTACTTCCCGCCCGAGCCTGGCACTGGTGCGC
CAGCGCTGTTGGAGAAGCTCTCGGCTCCTCGTGGCCTTATCCGCGGGTACACCTCGAGGGGTTCCTATGAGCGTGCTCTTGTTGAGAAAGAGCCACTCTT
TCTTGGCGACGTTGAAGTCGCCCGGTGTGTGCTACTAGCACCACACAAGTTCACACTGAAGGAGTTCACCACGCTTCGCAAGAAGCCGGAGGACAAGGGT
GGACTCCATCCTGTGTGGGGTTTCCACTGGGTCAAGCCGAATGACAACATGACCTGGAGCGAGGTGGAAGACCTCTTCTGGCGCTACGTCCAGCGCAAAG
GGTATTCCGACCAAGAGTTCAAAGAACTCCGTGAGGATCGCACTCTGTCCGCAATCCTGGACGTGCGCGAGCTCCGCATCGAGTTCGCTCAACTCGTGAG
CAAGCGCAAGCTCCACTCGAAGATGGACGAGCTGAAGCAAGAGGCGAGAGCCAAAGCTCGTGAAGAGCGTGGGCGTGGTGCGACTACGTCTGCTACCGTG
CCCCGGGTACCGGCCAAGAAGCCAAGGACTACTTACGAAGCTGCCGCTGCTTCTCGTCCCATATCGCAACAGCCTTCGGGCAGTCTGCCTGGAGCTGCTC
AACGGGCTCCCACGAGTTATCCGACTCAGGGTAACCCCTCCACTTCACGAGCAGCTGGCGCTTGCCATGGAGCCGCCGCTCCCGGACGTCTCGTTCCACG
TGGTAGTGGATCTGACCATTACGATCAAGGAGGGCCGGTGGTGGCCTCGCACGGCCATGGCTACGAGCCTGAGGCGACGCAGCCGTATGCTGGGGCCCCC
AGTCAGGTGGTGGCCTGCAGCAAGAGGAGATTCGTCTTCTCCGGGACCGTGTGTACGTCCTCGAGATCGCGCTTGGCGTCGGCCTTGGTGGCGAGGCTGC
CGCTCGTGCTGGCCAGCCTGGTGCCGTGGAGCGGCTCCGTGAGGATGTTGCCTCGCTCTATCAAGAAACTCGCAGTCTCCATGGCCGTGTGGATCGTCGA
GCCGACCTGTCGTCTTACGACTCGCTGCGAAACCAGCTCGCTGGCCTTCGGGCCAAGCTTCATGGCCACGCGCCGTATCCGGAGCAGCAGCAGCCCCACT
CGTATCAGGCCCAGTTTGGCCAGGGCTCGTACGGGGCCCCTGCGTATGCTGCTCCGATGTACGCCGCGCCGTCTTACGACCAGCGCGCGTATCAGGCGCC
TTACCGCGACCCGACGCCGCGCTTCGAGGAGCTGCGCTCTTCTCCACCGGGCCACCCACCGATTCCTGCGGGGCAGCCAGAGCCAGAGGGTCATGGTACC
TCTTAAGACGACCCACGTAAAACGTCGGGTGACTCGTCATCGACTTGGGCAAGTCTATGGTGTACGCCGCGCCATGCCGGCTGAGGACCGTGAAGGGTCC
AATGAAGCGGTGCTTCAGCTTGTTGCTTTCGACCGAGCTAACAGTGTTTAGCGGTAGGTTTCTAGTATCTAGGAGAACTAAATCCCCAACCTTAAACACG
TTCATGTTTCCTCTTCCATTTCGGTCAGAGTACTCCTTCTGTTTATCTTGGGCTTGCACCATGGTGTCTCGCACCCTGCTGATTATGTTCAGCCTGTCTT
CGGCAAACGAGGACAGTTGCTTCCGCAAGGTGGCTGGACTCACGTCCGAGACTTGGGAGGAAAAGGTTTTCCGAGCCTCTCCCCCACTTAGGACCGAAGC
CCCAGTACTGCCTCGTAATGCGAGCGGCACCTGAGGGTGGCGCAACCCGTTCAGGTAAAAAAGCGTAAAGCCCGTCGATGCATGTACCGCATTGTTGAGT
GCGAACTCAACCATGGGCAAGCGATCAGCCCAAGAGCGGGGCATCTCCGCGCAGATACTGCGGAGCGTGTCTTCGAGCACGCGATTGACGCGCTCCGTCT
GGCCATCCGTCTGCGGGTGGTCCGCCGTCGACATCGACAGTCGTGTGCCGAGAAGGCGAAACAGCGTCTGCCAGAACGTAGCGGTGAACCGCGGGTCTCG
ATCAGAGACAATGGTCTCGGGCAGACCGTGGTGTCGGAAGACACAGTCCATGAACAGGCGAGCGACCTCGTCGCCAGTGACGGTGTCACGAACTGGAGCA
AAGTGGACCATCTTGCTCAGACGGCACACGAAGGCAACAACACCAGTGTTGCCACGGTCATCGGCCGGAAGTCCGAAGACAAAGTCGAGACTCATCGACT
TCCAGCAGTCCGCTGGGACCGGCAGGCTCTGCAATGGTGCCGAGGCGTGACCGGCAGGCTTCACGCGCTGGCACGTCTCGCACGTACGGACGTAGGTGGC
GACCCACTTGTACATGTGACGCCACCAAAACATCTGCGAGACAGACGCGAACGTCTTCTCACGGCCGAGATGGCCACTGAATGGAGCGTCGTGCGCCTCC
ATCAG