Description :
From Genome Similarity Track
Location :
contig_55:163493- 164964
Transcript NameFunction/comments
g9273.t1hypothetical protein

Sequence
1471 bases(100 bases per row)
CTTGCGCACGTTCCTCAAATCGTGCACAAGCAAGTGGATTCGATGCCAAGACGTGAAAACTGTCATTATCCGATTTCCCTCGCGGGGCTCACTGCTCACG
TCAATCAAGCAAGATGCGTCTCTCCAACTTCGTAATCGTGGCTGCCGCTGTAGCTGGTCTTGTTGCCAGCGGGAATGCGCTCTCTCCGGCCGACTACAGC
AAGGTTTCGGAAATGGCGTCGCCCGATACGATCAAGGCTGTGCAGCATTACAGAGATAACTCCAAGAGGTCCCTGCGGGTTGTCGAAAGTGCCGATGAAA
ACGCAGACGACGACAACGAAGAAGAAAGGATTAACTGGACCTCTGTAGCTAAACACTTTCCGGGAACAGCGGCCAAGAAGGCGGCAGACGCCAAGAAGGA
GAAAAGTATAACGGCAAAACTAGCCCCGGCATTCGCGGACTACAACCGTGCCGAATTGCAACCTCTTGACGTTTACCGTGCGATGAGAAAGGAGGGCTTT
TCCAAAACAAAGGCGATGGAGCATGGTACCCAGTACCAAGCATACCTGACGAATCTGGGACTTTATTAATCTTCGCCGCGCAGCACACACTCCATCAAAA
GAAAGTCGAAAATCGTAACAAGCTCAATAAAACAAAACTGCTTTATTAACGTTTTGAAATGATTGTCGCGCATTCTAATGTTGCTCGAATGTTTCCCCTC
AGAAGGTTTCACTCAATGTGGTCTACATACGCCATTACTCCATACAAATACCTAGTCACTTTGTATCCGCAGCCACAGGATCACCTACGGTATGGCCTCG
GACGGTGCGCAGCTGCAGGCGACGGTGCTGGCGGCGCTGTGCTCGCTCTACCAGCCGCATGTGGCGGACCCGGAACAGACGCGCGTGGCCGACGCCTACC
TGCGAGGCTTTCAGCTCACGCCCGCGGCCTTCGACGTGTGCGCGGCGCTGCTGGACCAATCGCTAGCGACTCGTGGCGCGCGACAGAATTCCGTATCGCT
AAATTCGGACCGCGTCCCAGCTGTGTTCTTTTCGGCACAGACGCTGGCCAATAAGCTGCGGCGGCAGCCGTCCGCTTCAACTTCGGACGCCGGGATCTGG
ACGCAGCGACTCGTAACCTGGTTATCCTGCGGCGTTAGAGTACCGAAAATAGTGGTGACCCAGTTACTGTTGGCGCTTGTATCAGCGTTGCCGCGTCTCC
AGGCGCAGGATCTCAAGGTTCAAGAGACTCATGACGCAGTTGCAAGTGGCAGCCAAGTGTACGCGCTGGTCCGGGAGAGTTACACCCAGTGCAACGGCCA
GAGCGTCGTGGGCTACGCTCTGCTGCAATTGGCTCAGAAAGGGGTACCCTCGAGGTACTGGCCGAGTTACTGCGCTACTGGTCGAGGAAGTGGACACTTT
GACAGACAAAAGTGCGAGACAGAGAATGCAGGACGAGGTGGATGCCTGGGCGCCCGCGGTGCTGGACAAAT