Description :
From Genome Similarity Track
Location :
Scaffold_182:16349- 25177
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_182-fgenesh-gene-0.2COMPASS component SWD2
Pytap_DAOMBR444maker-pag1_scaffold_182-snap-gene-0.37Glucokinase
Pytap_DAOMBR444maker-pag1_scaffold_182-snap-gene-0.38Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_182-snap-gene-0.23Dihydropteridine reductase
Pytap_DAOMBR444maker-pag1_scaffold_182-snap-gene-0.39Transportin 3, partial

Sequence
8828 bases(100 bases per row)
AGCAAACCCAGTGAATGGCCCACAGCTAGGtgCGTGCTACTCGCCGGATGGTGCGTACGTCACAACAGGCTCGGAAGATGGGCGGgTGTTTGtGTACCGC
TCCTCGAACGGCGAACTTGTGCACACATTGGCTCGAGGTCATCAGGGAGCGATTCTAGACATGgCATGGAACCCACAGCGACACCTTCTGGGCACTGcGG
GCTCTAATTCATGTGTCCTGTGGAGTCCAGGGGTGATTTAGGACATACAATATTCGAATATAGCGCAATTCAAAGCACTTCAACGATCTAATGCATCTAC
AAGAGCGgTCGCGCAATGGCAGCAGCTCCAATGATGCCTGCGTCGTAGCCTGCACTTGCCTTCTCGATTTTGACCTGAAACAAAAaCAGCCATTCACAGT
TTGTGAAAaGTAGGAAGCCTATCGATTTGACGCACCGGATTcGGGAAGGACGACCACGCGTACTTCGTATACGACTTCCGCACAAGCTGAAGGAATGTCT
CGCCTGCCTCAGCGATCCcACcAGCAAGAACGATAATCTGCGACGCGGTCGATATTAGCGGCGAATTCGTAAGAGACCCAATGATGCATGCtcAACACTC
ACCTGAGGATCAAGAATTCGGCTGAAGGTGACACAAGCGAACCCAAGGTAGTCGGCTGCCTAGCGATTGATATCGAAAaCCGTTAGATGTGCACCCTGCT
CAaCACACGCCTCATTCCGCCGTATTATATACCTCTTCAATAAGCcGATTGCACATGGCGTCGCCCTCGGCAGCCACCTTGAAGATCAGCTGCGCGTCGA
TCTtGTCGGGCGGATATCCAGCGAGTAGTGAGTCCGCACCTGTGCGTATTTCCCGACAATGTGAGATACAACCGTCTCAGCGATGCAGAGGAGGCACACA
CCTGCAGACAGATGCTCTTGAGCCTCGGTCaCGAGAGCGCCAGCAGAGCTATAAGCCTCAAGACATCCTCTTTGGGTGCAGCCGCAGAGTCGACCATTGC
GCTCTACAATCTGCgTGGCATCGTTAACAAGACCAACCCGaTAAAGCAACCATGCATCGCCGTCCTACCATGTGTCCTCCTTCGATTGTGTTGGTACCTC
CTCGCACGAGTTGCCcATTCGCAATCACACCACAGCCAACACCcGTACCCAGTGCTACCACACGTCACAGACgaCATCAAGGACTCCACCGAAAAAGCGG
CATGGACACTGGGAaTCACGTACTGAGCATGACGAAGTCCCGCACGTTCTGgTTCGCGGTGCCgACCcACTGCTCCGCTAGAATCGCTGCATCCGCGTCG
TTGCACACAACAGCGGGCTTGTtGAATaTCGCCTCGAAgaGCTGCCGCAAGGGCACATCCTTCCATGTCGGGAAGTTATGCGCCGCATGGATCACGCCTT
CCTCGAGCATCAGACCAGgACATGcAACCCccaCTGCACGTACTGCACTGAGTTCCACATTGAGCTGGACAGACgTCATCATAGCATTAGTATCACACTC
ACATGTCCACCCACTTCACGATAATACCAACcTTAGCCAGAATGTCATCGGTCAGTGTCTTGGCATTCTGGACCACGACCTCCGGCCCCTGCTCCCGATC
CGCAGCCACTTGCTGGCGCATCAGCACGCGTCCCTCGCGGCTCACGATGCCCACCTTAATGCTCGTGCCGCCAATATCCACACCCACTAATGCTTCCGTC
ATCTTCCGTCTCTTGCTGCTTGGACCTCTTCaTCAACACACACAaCCTCTTCAAGAAGcGCGTACTATGATCCCTCTaTATCTTCATATCCACGTgaaCC
ACACTGCTCTATGTTGTGATctttAAGTACGCGTTACGTTCGCATAGCTCGTTGAAGTCACCCCTTcGAGCCATTTGGAGAACACATCATCATGCCGACC
TACCTCGACACTCCTGGGCTCTTCCCTCTCCGTCATGCGCAGCCGCCGGCCTCCACCACTATGCTGAGAGTAAAAGTATCCGCAGGCGCGGGTGCGACGT
GGCAGCAGCAGCATCAAGCCGATCTCCTGTTGCTGTCGGTGGTGATCGGCTTCCTGATCGGATCATACCTCATCTGCCGATACTGCCGCTGTCGCTGGCT
CTACAAGCGGCACTCTCAATACCCAGGACGGCGAGATGACGTGCATACGACGTATCGTTCGTATGGAAACGGACCGAAAGCCAGTGCGTTCGTACTGGAG
CcTGTAGCGGAGAAAAAGCGGAACATCAAGTCGCCGAGCATGCTCGTGAGTGACATGGAGCAGCCTTTCCTCGGCCCGCCAGACTATGACCAGCCTCCGC
CATATGAGCTTAGCCCGCCTGCGTACGAGTATCTCCCGTCTGCACCGCCTCTGTCCGACGATGCGGAGCACTCCCcACGACAAATCTAAGAGTTCCACTA
aTACACGTCCCCTTCCACTTCAGTTGAATTGTAGTTCATGCGAACAGGTCATCTACTTGAAGAGTAAGACTCGGCGCAATGGCACATGAGCTTTCATGGG
ATAAaTTAGCACACGAGACCACTCCTTACTTCTACTTGTCCTCTTCTTCGACCAGTCGCCGCAGCTGCACTTCCTGCTCTTCACCTTCCGCATCGTCTTC
ACCTTCTTTCTCCTCTTCCTCGGCAGCTCCAATGAGTGTCTCTAAATCCGGAGCATCAAATTGGCTCATGTCCGGTTGGCTAGAACGGGAACTTGACCCA
tGGTGTCGCGCCGCTTTCTCGTGCTCTCGTTTGTGCATCTGCAAAACCTCCAGGAGCAGCTGATGAAGAAGATCAATCTCGAGTCCCATGGCGATTGTTA
aTCCCTTGGCGTGGTTCTCATTCAGCTCCAGGATTACGGTACGGATACCGAGTGTTGTTGACTGGGAGACTCGGACGACGTCTTCAAACGGAACcACGGT
CGTGCGAGCGAAGAGAGGGACCATTGTTCGGTAGATCAGAAACCTGCAGATGGCATCGTTAGATAGATCTACACTGGATGGCGGAAGTGCAGGTCAATAC
CCGTATGTAACGTGGAGCCTGACTGGCACATTGTTGATAACGCAGGATCCATCGTAGAGTAGAATATCTTCGCGATTGCCCATGAGTGAAGGCTTGAGTG
ACGAGACTTCAGCTGAAGGGCTGTAAGAAGTGTAAGAAGGTTAAAGGTCTATGGGTGAACGAGACATAAACCGAGTGACcGATAATCCATACCAGTCAAC
TATAGCTTCCAGGGCACGCACTCGCAGGCTCTGAGCCGACTGCACTCGGGCAGTAACTTGCTTTCGCTTTTCGTCGATCTTTTGCTTTACCGTCGTCTCG
CATTCGtGTTTGTACTTTGCCCAGAGTTCATGAACGAGATCGGTGATCACCTCGCCGTACAGCTTTCCGCTCGACAATGCCTGGTCTCCGCTGGGCTCAT
CTTCTTCTCCATCAACTCGACTGTCGTTAGTATCAGCAGTTGCCTCCTCCGTTGACTCAGCTTGTGACGGGTTGGAAGTTTCCGTCTCAGTGTCGACACT
GTTCTGGATTTTGGAGACATCGATGTTGTACTTCTTCAGGAGCGGGTCAAGTAACCCAAGCAATAATGCACAGGCATATTCCTGGTTATGTGCGTATTCC
TCTAGTGGGATACACAGCTCGCGCATGTTTGCCTTCATTTCACTGCATCCAAGCCGTCAGGAATAAAGAtCACTACCAATGGCCAAGCAGAATAACTCAC
CGTAGAAACATCTTCCGCACGTCCGAGATATATCCCTTATCTAGCTGAATCGTATCTCCATCACgaCCTGGTTCATGTACTTTACTTCAATTCTCCTTCt
GATGAATTCCACAAACAATCGTTTCTCTTACCTGGcTCAGCGGTGTTCTCTGGTGTCGTCATGTATAAGTAGCTCGCCGTGAGGTACTGACTTGTGAGTG
TGGACTGCAGGGCTGCTAAGAGGCCATCCATCGAACGGTTTAACGCTTTCATTCTGTCGGCCGAAACACTGTGGAAATGCGACGTCTTGACACCACCAAG
CAGCTTTTGCTCATTTGAGACCAGGTATCCCATATGCAGCACGCGCAACTTGGACGAGAGAACACCAATGCTCACAAACAGATTCTGGTATGTGGCGGCG
TCCATCATGCCATGCGCtATCGAGTCCTGACCGACCTTCTTGCGAAAGAGCACTGTGCTCGGCGTCTCCTCCGCCAACACCATGCCGTGGCCAATGCTTA
CGGTCGCGATGAGCTCTTGAACAATCTGCCATGCGCGGTCCGGCCGCAGATGTACTTGTAGAAACGTCCATTGCGTCAGATCTCGCTCAACAGGCAAGCT
CTTGACCCACACGGCGTCCTCTTCTGCGAGCGTCTCTCTCGACAGAAACGTGAAGTCTGGGTGgTCCTTGACGGCCGTATCACTCTCCATCTCTACTGGG
TCACTCTCGAAGGACCCGGGGCGGTTCATACCGAACTCGTCTTCCTCATTCATCTCACGATCCGTTCGACGCATCATGTCACCTCGGCTTTTTTTCtGGG
TGTCAAAATGTGGCTGCATGGTttGGGAATAGTGTATGTAACGCCATATTGGaTTCGGATATTAGGTGTGACACGTAAAACAAGGAAATTCCAGGAATGG
CAACTTGTGTGCTGGATGGAAAGCACACatcAAAATGGCGAAGATTGAGGAGATCAAGAGCGACCTCGAACGCCTCGAGCGCTGGCAGGCCGAACACCTC
GCCTCGAAGCTCGATAAGGATGTATGAaGCTAATATACGGTGGTGcaaCAGTGCGAGAACGCTCTCTAATGTGTTGTGTACGAGTCGGTAGATCCAGCAG
CTCAAGGTGGCGATGGCGGAACTCGACACAGTGCGTCCGAAGAAGGTGGGCTAGCTGCTTcAAACTTACCTGCTCTGCTAAGAGTCAAACTCGCTGAGTG
ATCATTGtGTTGGAAGGCTACGTGTGTCAAGCGCGCCAATGTGTTCTTCATGGAAAAGCGGGATGTGATTGTCAAGGCGAAGCGAAGTATGTGGATTAGG
ATTTCACCGCCATGAAaCGAGCTACTGACGCTCCGATATGGTTTGCCTATGTGTTTCTGTAGATGAATtCCAAGGAAAGGAGAAGCTGCGCCATGATGTT
GGTGTGCGTCTGCGTTCGCTGTAAACGAgTTCTCCTCCACTCAATACCAATACAATAGATCATGCATTATCCCCcATTCTCGATGtCAACGCCATATTAG
TGTTTGTGCCTGTGGTGTTGTGCATTGACCCTGCTGTCTACGTGCTTCTTCACCCTGCTGTCATCAAGGCAGTGCATGTGATGAGACGGCATGCATTGCC
GTCGGTTCCCTGTCTTGGTGCATACATTAGCATCACACAGCGGAGGGATCCCTTGGAAGTTCAATGACACAtACCGTCCAttccGAATCCTGCAGACGAA
TATGGCCAAGCGATTGGTGGTGATTGGCGGCGCTGGTGCGCTGGGCCGCGGCGTGATCTCGCGCTTCTCGCGTTCGTCGTGGAAGGCGCTGTCCGTCGAC
TTCACGTGAGTGTGTAGCTCGTAAAATGGcGCATGTTCATTTCGCTGACATCTCGATCTGACACCAACAGGAAGAACGATGAGAGCGCCGAGTCGTTTGT
GTTTGACCTGGCTGCCGGTTCTAGCACGCtcACGCAGGCAGGCAAACTGCTCGATCATGTGCACAAGACCTTCGGCCAGGTGGACGCAGTGGTATGCACG
GCAGGTGGTTGGGCTGGCGGTTCCATCAAGGACGCCGACTCgCTCGTCAACCTCGCGGAGATGCACGCCAAGAACACCGAGTCAGCAGTCCTGGGTGCGT
AGAATCGCCGTCGCACTAGATTATAGTGATATAGCTTACGCAGTGGATCTATATTACtATGCAGCTGCGCATGTGGCGAGTCACGCGCTCTCACCTGGTG
GACTGCTAGTGCTCACGGGTGCTGCCGCGGCTCTCAATGGTGAGTGGTGATCGAGTAATCTCAAGGTGATTTGATTCAAGTCTCATGCAGCTCCTTTCcA
CAGCCACACCTGGTATGATCTCGTACGGCATCAGCAAGGCGGCTACGCACCATCTCATTGCCAGCTCTGTGTACGTCGCCGATATATGATCGTCAaTGTC
GTGGATTGCTGATTTGGACTTAAaCAGTGAATCCCTCCCGAAGGATGCGACAGTACTTGGCGTGCTCCCAATGACGATTGACACGCCTATGAACCGCAAG
TACATGGGTGATGCCGACTTTTCGACCTGGACAACCCCTGAGGAAATCGGCGAGAAGATTATCGAATGGAGTGAGGCGGATCCATCCGCCCGTCCTACGA
GCGGCCACTTGTTCACGGTGCTCACGGAGAAGAACAAGAGCACGTGGAAAGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTGGTGAAGTTGGATTTTGTCATCCAAGT
GGCCTGACTGGAGCTGATCTATTGGCATACGCTGGATTTCGCCGTACCACATGCCAACATTCTTCAGGAGATCCAGGGTTGAAGAGCAAACATCAGGGTT
CTGAGCTTTGAGCGCATGTAGAATGAGCGCGACCAGCGGTTCAAATTGATTCGAGTGGACAAGAATtAGTGGCCGTTTCGAGCCACAAGACAAAACCAAG
TCGAACAATGCTACGACGAGGGgTGGGTTATCATCCGCACTTCCACCAGCAGCAATTTTACTCAGAGACGTCTCCACCACGATGACAAACACTCGAGTAA
GGTTACTCATTGTATCGTCATCGTCGCCAGCACACTGGATCACTCCCTTGATAACTTTCAAGAAGTTGCCATCGAACGTGCGgCcAAACTGCTCCAGCAA
ATGGCTCATGATAGCCCCCGCCAAGTCTAaAGCCTGGAAGCGAATATTGTCGAAAACGCCCACCAGCATCCCACaaaaTTTCTCCATTACATCTTCGTTG
GTACcATATGCGCGGAGAATACCTTCCATCAACGCCCAATTCTTTTtcGAGTACAGTTAGGAAGGGGTGTGGGACGTCTTGGTCAATCTGAGGGGGGATT
TTCGTTGCAAGAATAGTCAGGTGATCAAGGATGGCTGAGAGAAACTCAACAGCAtcATCGTCATCGGGATTCATCGCGCCATAaCGTGATATATACTCCC
CAagCATGATTGAGCACAGTTGTGAGACGACAGGCTCAGCATCCTTGTAAGCTACTCCAACTAGAATCATCGCCATCGATTCTACAATCAATGCCAGGCT
TCCATCAAGCATACGACCTCTTTTCCGTGGAGCTACAAGATTTGCTCTGTAAAGCTGCAAAATTGATTCcATCCAAAGGGGGTTgAAAAGaCGAGTGCCA
CAACGACTTGCTAGCTTGCGAAGTGCCACAGAACCGACATGGTCTTCTTCGTCTCGTGCTCGGAATTGAAAAGTaTCGTTGGCTTCGGAACCACTTAGGC
TTTTCGACAGAATTTTGAAAGCAAACCGATCAATGAACATCGGATTTCGTGCAAACCAGTGGCTTGCGACACCCAACAGAATGGTGGCAGTGCGTTGTAG
GCCccGATGAGTTGGCTCGTCGCGGGATAAGTAGTCAAAAAGTCGAGGCACGAGGGATAAATCATCCTCGCGCAGCGACTTGGACAGCGCACTAAGGGCG
TGTACGTACACTTCCGTTTTGCGCcACCACTAAGATGAACAAAaTCAGTAAAAAtaCTTAAGAAATCAAACAAGCTGCACTTACCGACGAATCCACGGGT
CCGGCCTCAGCCAACTCGTATTGACGGAAAaTAGCGTGGATCGCATCAATGATGAAGCGATCTTCACTTGCgTGGGTCACTGTTGCTAACGCACGGAACA
CAGCTCGGACTTCGTTTCTATATGCCCCAAACTGATCTCTGACAGACTGAGAAACCTGTTCGAAGTTTTCAGGTATTTGCGTTCTCTCAATAAGGATACC
AAGCAAGCGTGAAATGAAAATCTCGAACTCTTCAATACGACGCTCGTGTTTGCCGGAGATGTACTGTCGGAAGTCAATCCAGAATTCCATGGTCTCGTTA
GAGATTTCGATGTCGTGGAGACTGGTGAAGAACAAGACTGTCTCGAGAAACTCGAATACGAGGGCTGCACTTGCAGCATCGACAGTGTACTCCACAAAGT
AGTAGATAAATGCTTGGCCACATTCACAAATCGCAGTTGCACAACTCTTCAACAAGAACATGACTTCCTGCGCAGCACCTTCATTGAGCCTTGATTGGAT
ATgaCGGCCCAAGTTGATAAACTCCGTCATTACAAATACCATTAAAGGAACTTGGGCGTCACTTCGGCACGCACGCACGACTTCGCGAATTACCTCGAAG
GCATCAGCCGAGAACATtGGAATGAGAGTTtCACGgAAGGAGCGGCTGAGGAGCCCAcTTtCAAGgAGCAAACCAGTCGGgACACTTCCGTATTCTACCC
AACTTGCGATGCATTGAAGAAGAAGTCCTCTtAATCGCGACTGACTCTCATTGGCATCGATCGTGTTGGCAATCTTGGGGAGTACTGTCTGCACGACGTG
TGGGGCTGCATGTTTCACCATGTTCTCGCACTCAaTGCGCTTGACTTTACTAAACTTCACTCGTTTATtGTCGAcTTCCTCTGGAATCAATTTGAGTGtc
AACAAGATCGCAAAGTTGGTCACATTGC