Description :
From Genome Similarity Track
Location :
contig_69:16349- 18194
Transcript NameFunction/comments
g9864.t1hypothetical protein

Sequence
1845 bases(100 bases per row)
GTTAATATCCCTAGGAACGTTTAGTTCCAGGGGCGCCGAATGCTTTCGTACACCGCCGGAGCGATTGCCAACTCTCTGTGAGAGAGCATCGGCAATGGTC
TGCATAGACCTTGCTGTCAGGTTCACATACCTGAACAGCTGCGACCCGTACGTGGTCGTGGACACGTAGGGCGTCCGCTTGGGTGCGCCGTGCCATGGAC
GCACGCACCCTGAAGCAATTGGTGTCGGAAAGCCATCGAGTCTAGCCGGCACCCAGCCTCTGGCAGAGCATTGGTGAGTCATGACCCCACCTCTGCCAGA
ACACACGGTATCCGAAAGGATTACCTGGACGCAATGGCGTCCGCCGACTTAAGGAAGTCGTCGGAGTAGTTGCAGCTGCAACAAGTGTTGAGATACCGTC
CACTGCGGGCAATGGACCGCCACAGGCAATGCCGGTGGACAGGACTAAAGTCCAGCGAGAGGAGCTGCAACGCCAGCAGCACCCACCGCTCCTGATCGTG
ACGCCATACAGGTCTCGACTGTATCGGCGCCAGGGGATGTAAGTCTCCCCAGTAGAACAAGTCCACGTGAGGCCAAGACGGTCGAGACCGTGGCCAGGGC
TGAGGTTTCCGAGAGCACCTCCTGTGTGGGTAACAATGTGCCACGGAGTCGATGAGACTCCCGACTCTGCCCTTGAGTCACCACCGGCCGTGGGTAACGA
AGAACCACGCCGGGGTAGGCAATGACGACGTCGTCGCCGCCGTAAACCGAGTCTGTTGAAACAGACTGGAGTCGCCACGAGCGACTCGGAGTAATCAACG
CTCCTCAGGCACGGCCGGCTGAAGATGCTATCACATCTTCGACCGCGAGACCTGTCAGGTCAAGGCGGCGGTCATAAGTTTGACCGCCCTGCCGGAGGTG
TCAGAGTTTTGACACGAGACTGAGTGCAATTTCTCGGTTGGAATCAATGGGTGACTAGTGACGTGGATATGTGCTGATATTTGATTGGCTACTGAAATTT
TGAGTACTGGTTATGCGCATTGCGCATGTTGAATGTGGAATTCGGCTGTGTTCCGCGGAGCGGATGCGCTCAGGCTTTAAGATCCCCCCCCAGATTTGGA
AGGTCAGATTAGGCTCCAAACAGCCTGAAACTGGATCTATGTCTGAATAACCCCGTCCTTAAGCGGGTTAACCCAATGGAGTTGAAAATGCCTATGTGAA
TGTATCACATATGGTGTCCCGCCTTGCCTAAAGCCTGAGCGTGTGAATGTCCGTGTACCCGGAGTGCACCGTAAGCACCAGACGCCAGACAAACAAAAAG
CCCGTTGAAGAAATGCCGTCTGGACACTCACAATGAAGTATGATTTTGGTCATGAGACCTTGATCACATTAGATGTCTGAACGCAGATGTCTGAACGCGG
ATGTCTGAACGCGGATGTCTGAACGCATGTATTATACGTGCTCAAGACTACCCGGTGCTGTGAGGTCGTACACACTGGTTTCAGCTAAATGTCCAAGTTG
AAGAACCCTGAGCGTGAGTTCGAAGTATCTACGTTCAAGAAATTGGAACCTGAAAATGATGTTCAAGGTCAAGTAACTTGAAAGTAGGTTTAAAGAACCC
ACGTTCAGACAACCCAGAACCCAATGCGACGATTTGACTCCTTGAAGATGGAAAGTGAACCCACGAAGTGACAGCCAGTATACTCAAGTCAAGTCAAAGT
CAGAAGGTCGCCAGGAAGAACACAGAAGAACACAGAAGAACGAAGACAGACAGATACCCTTTACGAAGAAGCTAGCGATCGGCTAGCAAAGATAACAATC
AGAGTTCGTTTAACCACCTACTACGCAAGTCGCTCAAAGTAAGTC