Description :
From Genome Similarity Track
Location :
Scaffold_365:1634- 8440
Sequence
6806 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATAGTAGTTGTGTTTTCGGCTAATAATATTACTATTTGATACTAGAGGCATATTGGCTAACGCAGGGA
CACATGTTGGCGCTCGGTCGGTTCAATAGAGAAAACGGATTCGCTGCTGGGAGGCTCGCGCGTTCGGCGGTCGCGGTTCGTCGCACGGGGCCGGTCTACT
AGCTCAGGGTAGAACTCCACGCCTCCCAGTACTTCGGCATACGGTTTGTACAACGACGAAAAGTCAAAGCAACCCTTCTTCTCAGGCTGACAGCGACGGC
GGCGCCTAGTGTGACGGGGCACACAGCACTTCTTAACAGAGGAAGCAGGAGTATACAAACTCCAAGTGAACAGCCGTTCACGTGTCCCTGGTCTGAAGGG
GACGACTTGACTTGAAAAGCGGTAGATCTAAGACGGAATGTATTTATAGGCTGGTACAGATTTGGCCTGCATACAAATCCTAAGTTCCCTTAGTTTGTGT
CATACAAAATGTATCTATTGGCTCTGAGGCCACTTGGGTCACTATCCAGGGGAGTGATCGATGTAGCCATCCCGGAATAGTGACAGGGTCACTATTCCAT
GTAACCCCATTACATCCTCCCCCACTTAGATTCGATCTTATCGACCAATCAGAGCGAGGTTACGCCGGCGACTCACATTTCACTCGCAAAGTCGAAATCC
ATCGACAACGGCGCGAGCTCTGGCGCCTCGGCTCCCGGGCCTCACAGAGCAACTGGCGCATCGCCGAGCAAGCCGCAGGGTCTCCACGTTGACCGGAAGC
ATGCCTCCAAAGCGCAGTGCGCGCAGTGCGAAAGCACCTCCGAAACCGCGGGCCGTAGGGCCGAAGACCAGGGCGGCCAAGGCCAAGGACGAGTCGTCCG
CGCTGATGGAGGCCACGAAGGCGGCCGAAGAGGTGGTGCGCTCTCGTAGCAGCACGCCGGAGAGTGGTCGTCAGGCCGGGGCTCGGAGCAAGTCTCCTGA
CGCCGCACAAGGCAAGGAGGAGAGTCCTCGGGGCCATAAAAACCCGGCTCGCGACTGGGAAGCCGCCGTCTTTGACTGCACGATGGTCCAGTACTCCGGT
GAGAGTTCACCCGACGACGAGAACGTCTCGGAGGGCAGCACACACGCTGCCGAAGGCACGGAGCTGGCGGCAGGCGACATGACCAACGCCTCGGCCGACG
CAAAGGCCTCGTCAGAGAAGGAGGCGGAGGACGCCGAGTCCGGCTCAGGCGACAGCAAGCAGTCGCACGACGAAGTCGCCATGGCCGACGCTGGGGTCGT
GGCCGAGAAGTCGCCGAGCGATGCGGGCTCCAAGCCCAAGGAGGTGCTGGCATCCAGGCATCTGACGCTGGCACAAGGTCATGAGCGTGCCCAAGCATCG
AAAGCGGCTGCCCATGCGAAGGCCGCCGAGGCCAAGGCGAAGAAGCGTTCAGCTTCCAGGTCGCCTCGCGGCTCCAGCTCCAAGCTGTTCATCGACTCGG
AGTCTGAGGACGAGGAGGGTGCCGTCCACGAGCCCAAGGAGCTCTCCAACAACCTCGACGAGCAGCAGCAGCAATACCACGCTGCTAGCTCGGGTGCGTA
TGCCAGGCAGCCGACTGCCAGGACTGCCATCGAGTCTTCTTTAGGCGGGGATGCCACGTACCCGCAGGGCTACTTCCCGCCCGAGCCTGGCACTGGTGCG
CCAGCGCTGTTGGAGAAGCTCTCGGCTCCTCGTGGCCTTATCCGCGGGTACACCTCGAGGGGTTCCTATGAGCGTGCTCTTGTTGAGAAAGAGCCACTCT
TTCTTGGCGACGTTGAAGTCGCCCGGTGTGTGCTACTAGCACCACACAAGTTCACACTGAAGGAGTTCACCACGCTTCGCAAGAAGCCGGAGGACAAGGG
TGGACTCCATCCTGTGTGGGGTTTCCACTGGGTCAAGCCGAATGACAACATGACCTGGAGCGAGGTGGAAGACCTCTTCTGGCGCTACGTCCAGCGCAAA
GGGTATTCCGACCAAGAGTTCAAAGAACTCCGTGAGGATCGCACTCTGTCCGCAATCCTGGACGTGCGCGAGCTCCGCATCGAGTTCGCTCAACTCGTGA
GCAAGCGCAAGCTCCACTCGAAGATGGACGAGCTGAAGCAAGAGGCGAGAGCCAAAGCTCGTGAAGAGCGTGGGCGTGGTGCGACTACGTCTGCTACCGT
GCCCCGGGTACCGGCCAAGAAGCCAAGGACTACTTACGAAGCTGCCGCTGCTTCTCGTCCCATATCGCAACAGCCTTCGGGCAGTCTGCCTGGAGCTGCT
CAACGGGCTCCCACGAGTTATCCGACTCAGGGTAACCCCTCCACTTCACGAGCAGCTGGCGCTTGCCATGGAGCCGCCGCTCCCGGACGTCTCGTTCCAC
GTGGTAGTGGATCTGACCATTACGATCAAGGAGGGCCGGTGGTGGCCTCGCACGGCCATGGCTACGAGCCTGAGGCGACGCAGCCGTATGCTGGGGCCCC
CAGTCAGGTGGTGGCCTGCAGCAAGAGGAGATTCGTCTTCTCCGGGACCGTGTGTACGTCCTCGAGATCGCGCTTGGCGTCGGCCTTGGTGGCGAGGCTG
CCGCTCGTGCTGGCCAGCCTGGTGCCGTGGAGCGGCTCCGTGAGGATGTTGCCTCGCTCTATCAAGAAACTCGCAGTCTCCATGGCCGTGTGGATCGTCG
AGCCGACCTGTCGTCTTACGACTCGCTGCGAAACCAGCTCGCTGGCCTTCGGGCCAAGCTTCATGGCCACGCGCCGTATCCGGAGCAGCAGCAGCCCCAC
TCGTATCAGGCCCAGTTTGGCCAGGGCTCGTACGGGGCCCCTGCGTATGCTGCTCCGATGTACGCCGCGCCGTCTTACGACCAGCGCGCGTATCAGGCGC
CTTACCGCGACCCGACGCCGCGCTTCGAGGAGCTGCGCTCTTCTCCACCGGGCCACCCACCGATTCCTGCGGGGCAGCCAGAGCCAGAGGGTCATGGTAC
CTCTTAAGACGACCCACGTAAAACGTCGGGTGACTCGTCATCGACTTGGGCAAGTCTATGGTGTACGCCGCGCCATGCCGGCTGAGGACCGTGAAGGGTC
CAATGAAGCGGTGCTTCAGCTTGTTGCTTTCGACCGAGCTAACAGTGTTTAGCGGTAGGTTTCTAGTATCTAGGAGAACTAAATCCCCAACCTTAAACAC
GTTCATGTTTCCTCTTCCATTTCGGTCAGAGTACTCCTTCTGTTTATCTTGGGCTTGCACCATGGTGTCTCGCACCCTGCTGATTATGTTCAGCCTGTCT
TCGGCAAACGAGGACAGTTGCTTCCGCAAGGTGGCTGGACTCACGTCCGAGACTTGGGAGGAAAAGGTTTTCCGAGCCTCTCCCCCACTTAGGACCGAAG
CCCCAGTACTGCCTCGTAATGCGAGCGGCACCTGAGGGTGGCGCAACCCGTTCAGGTAAAAAAGCGTAAAGCCCGTCGATGCATGTACCGCATTGTTGAG
TGCGAACTCAACCATGGGCAAGCGATCAGCCCAAGAGCGGGGCATCTCCGCGCAGATACTGCGGAGCGTGTCTTCGAGCACGCGATTGACGCGCTCCGTC
TGGCCATCCGTCTGCGGGTGGTCCGCCGTCGACATCGACAGTCGTGTGCCGAGAAGGCGAAACAGCGTCTGCCAGAACGTAGCGGTGAACCGCGGGTCTC
GATCAGAGACAATGGTCTCGGGCAGACCGTGGTGTCGGAAGACACAGTCCATGAACAGGCGAGCGACCTCGTCGCCAGTGACGGTGTCACGAACTGGAGC
AAAGTGGACCATCTTGCTCAGACGGCACACGAAGGCAACAACACCAGTGTTGCCACGGTCATCGGCCGGAAGTCCGAAGACAAAGTCGAGACTCATCGAC
TTCCAGCAGTCCGCTGGGACCGGCAGGCTCTGCAATGGTGCCGAGGCGTGACCGGCAGGCTTCACGCGCTGGCACGTCTCGCACGTACGGACGTAGGTGG
CGACCCACTTGTACATGTGACGCCACCAAAACATCTGCGAGACAGACGCGAACGTCTTCTCACGGCCGAGATGGCCACTGAATGGAGCGTCGTGCGCCTC
CATCAG