Description :
From Genome Similarity Track
Location :
Scaffold_484:1634- 5749
Transcript NameFunction/comments
Albla_Nc14134020conserved hypothetical protein
Albla_Nc14134030importin subunit alpha putative

Sequence
4115 bases(100 bases per row)
GCTGGTTTTGACGACAGCATTCGATGGAGTACTCGCAGTAACGGATTTACGCTGGCATAGTGTTGTTGCTCGATACAAGCTTCCAGCTCAGAAACGTCAA
GGCTGGTCATGCAGCTTTAGCCAAAGTGATTCCAACATCATTTTATGTGGCTTTCACGATGGAACCGTCGGCAAGTACGACTTGAGAAGACTGGATCATC
GCAATACAGACGAACAGAATACATTAATGTTTTGGAAATTACCTCGTCGACAACCTGTTCACTCTTTGGAAACCATTTGTTCGGAGGATGGGATCGAGTC
AATAATGGCCGCGACGTTCAATAGTTGCTCTGTATGGCGATTCGACTCGTCTGAAACACCCAATGATCAAGAAGAAAATCAGATGAAGACCATACCTTTC
GACGGTAATTGCACTTCTTCATCCTGGACGAACAATACAATCCTCATATCCACACGCACTCAGAAGGAAGCCATTGCCAAGCATATTCTGTACAACCTAC
CGCCACCGAGTGAGATCCCAGACTTACTCACGCCACGATGTACTCTAATGGGTCATTCGACGTCCACGATGTTATGCCGCTCGGCGATATGGAAGCATCA
AGATCGCACTCTGGTTGCATCTGGAGATGAAACTAGCAAATCTGCTCTTATTTGGGATGCACAGACCAAACGACCTATCCATCGGATCACCAATCTCCAT
CCATCTCAGCCTGTAGTGGATATCCATCACGCAATGACCACGGGCAATCGACCGAATAGTGAAGCTTTATGCGGATTTCTGTGTCCTTCACAACTTGTCA
TGTATGCTTATCAATCTTAAGTACCACTTCATGCTGTCCTTGTCGATCGCGCCTACAGGACGCCTTATACCTTCCGCCTCGTGCTCATTGTGTCAATCAA
TGCGATTTCATACTTTATTGTAATATTATAATATCTTATGATTATGTTGGATATAATGCTATAATCATCGTTCAGAATTAGAGTTGTGAATAATATCATT
TGATCTGTTCTTAAATTCCTGCCAGAATATTTTTAGTTTCTGGCGGTGGCGGCGGTCCGTAACGTGAGAATTGATCCGCAAAGTGTTGATTACGCACTCA
ATCGAGAAAAGAGAGTTTAGACAAGGGAACAGATCGTCATTGATCCAAAAATCTGACGTCAAATCGGATTCTTATAGCTCTATTCCGGATATATCAACAC
CATCTGCTCTCTGCGAATCTTGGGCGATTACGAGAGAATATCAGACAAAACAACAACCTGGACGATACCTATCGCATTCTGTGAGCACGAATTAGCTCAA
ATCATCTCTTAGAGTACCAAACGTACGCGTTTTAAAGTCTAATTGTGTGCCTGAATTCTGAAGTGATTTTTAGGTAAGATGAACATAAATTCAGTAAAAG
CAAAGCATTCCAAGCAGTTCTGGTCACCGTCCGAGGTCGCAGAGCTGACAGCAGCCGCTGTTGCAGCATTACCATCTCCATTATCACCAGGAGCAAATAT
CACAATCAATGCATCAGCAGCTACAAAAACGTCGAATCCAAATGTGATTGTTCATCCAGGCGCTCCGTCTTCTTCTTCGACCATTTCAACACATCGAAAC
GAGAATGGAGACATTGTGCATCATCATCAATCAATGCATCTTGGGAATAACGCAGCGCTATTGACTTCGACAACGACGACGATCCATCATCATATATCTG
GTGCTGATGAAACGATGCTTGGTGGAGCGAATGGAATGCCCCTGAATTCAGGCTTTATCCATCCACAACAAGTTCAAATTCATAATCATATCCATCGTCA
TGCGTCCATCTTCACAGAATCTTCTCAACACGCCCATCAACTGAATTTCACCGCAAATAAAGTCGACTTGCAAGCATTAACAAACTTGCATGGGAAAGAC
ATTGGAAATGAAATCCTCGCATCTTCGAGCTTTCAGGGAGATCTGAACAAGATTGACATTGGATTAAACTCGGAGGACGCAGAATTACAGCTGGAGGCTG
CAAAGAAACTTCGTATTTTGCTCTCATCCGAAAGAGACTTATTGATTCGTCAGGTCAGTACCCCCGGTAGAAAAATAGATGGAAGGATACTAACAATAGC
TGTGTTAGATGCTCGAGAAGAATTGGACGCCGCGGCTTATCAAATGGCTTCGACTCCGAGATCGACCGACTCTGCAAGTGGAAGCACTTTGGGCATTGAC
AAATATCGCTGCAGGAGCTACTGATAACACCGCTGTGCTGCTGCAAAATGGAGTCATTCCGACACTTGTATCTCTACTTGACTCCTCGAATGAAGAGGTA
CACTCATTCGATGCTGGATGATTCCTTTGGTAGCCAACCTTGCTCCATGTAGGTCTTGGAACAGTCTATATGGGTCTTAGGCAATCTAGCCGGCGAAGGA
TCCGCGACGCGTGATTTGGTTCTCAGTGCCGGTGCTTTGGCTCCACTGGTAAATAATCTGAAAAAGACTCCCTGGGATCGACTGTCGCTACTTCGAATAC
TCACTTGGACACTTAGTAATCTGTGTGACGGACAGCCACGACCGGTGTTCGATATCAGCATTATTCTGCCCTATCTTGCCAAGGTTTGCTCATCAGATTG
GCATCATTTTGCTCTATCATATATCTCTCAGCTTGATATGATTAGATGCTCGCAAGTACAGACACTGAGATATTGAGTCACATTTGTTGGGCATTCTCTC
ACTTGTGTGATGGACCGAGTGCCCATATCCAGGCTGTGGTCGATTCAGATGTTTGTTTCCGCCTCGTGGAACTTCTCAGTCATTCATCCTGGCGAGTGAC
CAAGCCAGCTTTGCGTGCTATCGGCAACATCGTGTGTGCTGAAGACGATCATGATTACACACAGCACATTATCGAATGTGGAGCGGTGCCGTCACTTCGA
AGACTTATAGCTCATTCCAATCGCGAAATACAGAAAGAAGCATGCTGGACACTTTCCAATATTGCTGCAGGAACGGTCGATCAGATTCAGTGTGTGCTGG
ATTCTGGTTGTATTCCATCACTCATGAATTTGGCTTCTGCAGAAGCAACAGACGCAGAAGTCAAAAGTGAGGCTTGTTGGGTGGTTCTCAATGCAACTTC
TTGCGGGTCCGATAGTCAGATTGAGTATTTGGTGAATGAAGGATGCATTCAGATACTCGGAAATCTGCTAGAGGAGACCAGTATGGTCATGATGGCGTTA
GAAGGTCTTGAGCGAATCCTCCAGGTGGGCGAGTTAGAAGCAAAGCGGACAGATGCACCGAATCCGTACGCAGGCTTGATGGCCTCTGCGAATATAGAAA
CTCTGGTCACACACAAGTCAGCAACGGTAGCAAAACGAGCTTCTCGAATATGGCAACAACATTTTGTGACGTGTGCGATTTGCATGGGCGCATTCTCCAA
GCATTCCAACGACACTTTTTTCTGCGACGAATGCAAATGCAATGTTTGCAAGAATTGCGATTGCACCGTGTTTCATTTGAAATACCAAGAAAGTCTTTGG
AAGGAAGAAACTGAGAAGGAGACCAATGAGAAGCAAGCCAAACAGGCTTCCAAACGAAGCAAGCGACAGAAAAAACGCCAGCGAACAAGGGAGAAAAAAG
CGGCAATGCGTCAGCAACAAAAGATGCTTTCCGATACAAATGGAACTTCTCGGCATTCCTCACAGATCCATTCAGCCGATATCAAAGCTAATGTCAGCAA
AACTCCTTCGACATCTTCCGATGACGAGACCAGCTCGATTGAGAAAACGCTCAATGGGACCACCAAGACAAGGCGGCTACGCGATAGCAGTAAGAATCCA
TTGCAAGAAGAAGATACAAGCGATTCCATAATCGACAAAATGAAGCATGTCAAAAGTGCTCCATCCTGTTTCCAAGATACTATGCGGAGCGTCAAGAAGG
AAGAACGGGAAGAAGAAGCATTAGATAAAATGGTGGACGCCAACGATCAGCTCGTGTCGTACTTGCTTGAAACAGGATCCATCATGGCCTTGGCAGAACG
GCTCGATTTGGAAGACGATAGCATGTGGATTGTTGCAGAGAAAGATCGAACCGCGATCCATGCGTGAATCAGTTCATTTTGTGCATTTGTCGGGCAGAAA
TTTGTTGAACACTTA