Description :
From Genome Similarity Track
Location :
Scaffold_770:1634- 5697
Transcript NameFunction/comments
Phymu_g11911hypothetical protein

Sequence
4063 bases(100 bases per row)
agcagaagcgctggaacaCATATGCCGTTGTCCGGTTTCGTACCGATGGCGATGGCCGCGCGAGGATCCGGAGGTGCCGTGTCAATGGATTCTGGAGTCG
CTTTCCAGATTTCCCACGAGAACCCAGATGCGGAAGGGCAAGATGTCACGCAGGAGCCTGGGTTGGAGCGTCAGAAgccaaagaggaagaacgcAAAGTC
TTCATCTAGACGGCGTGAAATGCTTCAGGAAGCCCAGGTCGCAGAAGCGTCTCGATCACGAGGTATCCGGAAGTCTGGAAGTCGAGATCGTGAGGTTCCG
GAAATCCCAGCAAGGTCTGAACGCTCGTCGAAGTCCGCTAGTTCTGGATCCACACAGGTCGCCTTAAACACCATGTTTCAACTTCAGAAGGTGATGGCCA
GAATGGAAGATCAACAAGGGTccgcactggagaagatgtcTGGAGATCTGGATGTGAAGCTTGAACGTCTTCTGGATTCCAAGTTTCAGACactcttcca
gaagaaggaagcggTCCCAAATCTGGTCGCCGATGAAGCTTCGCATCTGGAAGTCAGGAACCTGGAGGTCCGGTCATCCGGACACCAACCCCACAAGCGG
CACCCGGAATCGGTTCAGAGTTCCGCCGCCAAGACGAGTCCCGCCAGGGACgcgaaggtgaaggagcttcagcgagaactggaagccTCAGAAGCcgcga
ggaagaaggagggcgAAGCCGCGAAGGCTGTTCAGAAGTTTTTGGCTACACAAGTAAGAGATCTGAAGTCAACGGCTGCGAAGGCGACTGGAATTTCTGA
GACAGAGGGTCGTAATCATGATGttcaagaagcaggtgcTCCTCATCGCACAACGCTGCACCCAGTATCCAGTGACGCATCCCAATGTGCATCCCATCTG
AGTTCCCGAAAAACAGATGTTGGGAATCCAGATGAAGCCTTCGCCGCCCAGCTTGCGAAGGCCCTCCAACTGGTCACTCGTGAATCCAAGACGCCTAAGG
CTCAAGCGTCCAGGACGCCGACACCACAAGCGTTGGTGGGGAAGAAAGAGCCGACCTCTGGAAAGAAGGAGGCATCTGGAAGCGGTAGCCGAGGCATCCG
GAAGCGCTCGACTGACGATGATTCGAAGAAGCGTTCGTCCAAGCATTCGGGGTCAGCGAAGCGGAGTTCGACGTCCAAGCGTGATAAGGGGGAGGCTTCC
CAGAAGAGAAGCCCTTCAGGATATCCAAGTTCCTCGGATCCAAGTTCCGACTCGAGTAGTTCTTCGGAATCTGGAAGCTCTGATAGCAGCTCTTTTGAGG
ACAAGACTCCCGCTGTGATGACGACTACGTCCGGTGGAACGACGACGTACATGTTCAAGCCTTTCGTGAATGCGAGTACTTTGGAAgacttcaacgagaa
ggCACCTCTGGCTACTCGGATGCGCTGGCTGGAACGGTTCCAGAGTATGTCGGTTCAGGGTGGCTGGGCTGATAACGTGAAGATTtacgagatgaagctc
aagttgtCTCCTGCAGTTCGGAACTGGCGTGCGAATCTGAATCCGAAAGTACGTCGTAAGTGGAAGGGATTCTTGAAGGCTTTCAAAGAGCGCTACTGCA
AGGCGAGGACCCCGGATGCGGAACGGTATTACACcatgatgcagaagaaacaTGAGACGCCTCTGGATTTCTATTACCGCCTGAACAAGGTGGCGGATAG
AGCTGGCATCCAGATCGACGGATCGACGAGGTACCGGGAACAACATCTGAAAACCTTTACCAAGAAACTTCTGGATTCCAGACTTCGAACGACCCTCCAA
GGCCAACGCCTTCGGAGTTTGGAAGATGTTGAGTACGTCCTGAGGCAACATGAAGAACTGAACCTTGAAGATGACTATGACACTCCACCTCCGAAGCGGG
ATTTCCGGGCAGATAATGTACCTCGTGACAAGTTTCGCCCGAAGCGTTCCGGATCCGGAAGGGCATACACTGCTCAGAGTGATGCTGAGTCTGAGGACTC
TGATCGTCATGTCCGTTTCCAggatgaggaagagaaaGTGACGCCACAAACCTCGAAGACATCTGCATCATCGAAGTCTGGAGATTTGGAGTCCAGATTC
CCGACTATGGATGACCTTTCGGATACTGTCTTCAAGATCCTCCAAGAGGGAGGCTGGAAGCCTCGATCCCCTTCAGGACGTCCGGACGAGCGCAAATCTT
TCGACCATCAGGAGTCCAAACGTCAAGGCTTCCGGAATCCAAATTACAGTGGGCGATATTGTGAGAATTGTCGCAACTTTGGGCATGTCAAGGAAGATTG
TTGGGCAGATATCGAGTGTGAGCGTTGTCATCGGAAGGGCCATCCAGTGCGATTCTGCCGAATGCGCCAGTGTGATTTCTGCAACAAGTATCACGATGGA
CATTGTGAAGAGCTGAAAGCCCTTCGGGAGCTCAAGAATCTCGTTCGACAAGGAGCTTTGGACATACCGACTGCCATCCGGAAGCAACTTCTGGATGAGG
ACGCTGATTCTGGGGAACAACCATTAAACTAGAAAGCCCGCTGGATGGGGATCCAGAACGCGCCGGGCTCAAGAAAACCCCAGAATTGTGTGTCTTAGCG
TACGTTGGTCCGGAATTGAAACGACAAGTTAACCATCAATGCATGACCGTGACTCAAGACGATGACTTTCTCCTTCATGATTCCAAACTTTCAGATGACA
ATGATTCTGGATCTTCAGATGATTGGAATCCTGATAATCTGGATGGCACTCCCGTGGAATTCAGATTGAAACCTGGTGAAAGCTACGGATGGTGGGAAGA
ACATCGTTCGGAAACATCGAAAAGAGTTGCAATGGTGCATGGTGCAGTGAGCAATGTCAGGACAGATATCCTTCTGGACTCCGGAGCTTCCGTAAGCATG
CTGAGTTTGGATCTTGCGCGTAgactcaagctcaagctaGATTTCGGAAAACAGCTTCGGGTGTCCGGATTAGGAGGCGTCCCGACGATTATCACTGCCC
GAACCGAAGTGAAACTCACCCTGGGTCTGAATGTGGTATACATTTTGGAACTTTGGGTGGCGAACATTGGTGAAGGTGTTGACGTGTTGCTTGGAATGGA
TTTTATGTATTCGGCTGGAGTGCGATTATGTGTTCGTGAAGGGCTGGTTCAACTCCCGGATGAAGAAAATGTCATGCTTTCAGGAAGAACTTTcgaccag
cagaagaagggATTACGTTTGGAAGTCCGGAGTCCGGAAACCCTGAAGCTTGGACCAGGTGAACAAGCTGTCGTCCGGATTATTTACGGGCAGAGCAATC
CGCAACGGAAGTGGTCTGGGCTGGACGAGGTGATCGCTGGGTGACGCAGCTCATCTATGGGGCGAGTTCCTGGGCGATTGCTGTGAAAGTGGTGAATATT
TCGGACAAGGATGTTTGGATCGACTCAAATACCCCGATCGCCCAGATTGTGGAATACGGATGCTACCCCTTCGGAAGGTTCGTTCGACCTGGACTCCGGA
GGTATCGTGAGTGGGAGGTCCTGATCTACGAGAACATCAATTCTCGCCAGGAGCAACTACGTCAACGAAGATACCTTCAGGCGGTCCAAGCTGCCCAACC
TCCAAGCGTCCAGAAGCCGGAATACCCCTGGCCCAAGCAACTTCTGCTGCGACCTTCACGCGGTGATTCTAAAGTTCACATGGTTCGATTACAGGACCGC
CCGAAGAATATCCGGAAGAATGAAGAACTGCGTCTGGACGCACTCATTCCAGAGTTCCGGAATCCGGATGGCGGATCAACTGTTGATGGACATCCGGATG
CGGAAGACTGTGGCTTTGTAGATTCCGATGGagacgagttcttcgacgCAATCGGCATAGATGACGATGATCCTAGGGATATGCTTCCAGGTACACCACC
CGTTGAGAACCTGGAATTTGGAAGGAACCCACTTGAAAGAATCTCGAAGCTGGATGTTGTCAACAAGGCTATCCTGAAGTTGGAAACGAAGTCCGTCCGA
TGCTTACATCTGAATGCAGAGGAACTAGACCTGGAACCAGCCGTGTACGTGCACGAAGGGAGC