Description :
From Genome Similarity Track
Location :
Scaffold_1:163394- 166322
Sequence
2928 bases(100 bases per row)
TTTTTGCTTCAGTAGTATACGCCAGCGGTTTGCCGTTGTCGACATTTTGTTCTGAAGAATGGAAGGAATTTTACAGAGCTATGTGCCCGGCGTATGAGAT
GCCATCTCGATATGTTCTCTCCAATCGCCTCTTGGATGATGAATGTGCAAGGATCAAGAAGATTGTGGAGCATTACCTGAAAAATAGCCCTTCAGGATCA
TTTACTATAACTTGCGACGGCTGGAAGAACATTAAAAGGGACCCTGTAGTCAATATTATGAATGCCACTCCAACGCCGATATTCTATAAGGCTGTGGAGA
CTGGAGTTAATTCTCATACTGGAGAATACATGGCCGCTATCATAAAGGAAGGCATTATTGCCATGGGCGGGACGACTACACTGATTTTACGAGCCGTGGG
ATATCAGCTGTCGTAACAGATAACGCCTCCGCAATGAAAAGGCATAAAGAATTCTCAGAAAATAATCCAACTTTGATTACCCTATCTTGTCTGTCGCACA
CCTTGCATCTGGTTATCAAGGACGTTTTACGGTATGACCCATTTACCTCAGTGGTCGACAATTGTCTAAAAGTGACTAAGTATTTTTTGAGTAACCATCA
TCCGAAAGCCATTCTTGAAAAGTGCATGACCGCAACCAACGTTCAATTTAGAAAAACCTTAAAGATTCCAGGTGATACCAGATGGGGTTCACACTTTCGG
ATGGTTGATGCTGTCTCAAATGCAAGGCTAGTCTTCCATAACCTTGTGTTTATCGCTAGTGAAGAAGTACGGGAAAGGAATGCTTACCCGTGGGACAAGA
CCATTCCTTCACTCTTAAAGTCTGACGAGTTATGGAATGACTTGCCATTCTCCATCGAGTCCTAAAAAAATTCAACAAGATCCTCGATAAGTTTCAAAGC
GACGTACCCACGTTGAGAGATGTTTTATTTGTTATCGAGAGCATCCGCACTGGAACTATGATCTTTTTGCATGGAAGGAAGGGCTCTTAGAGACAGAAGA
ACAATATACTATCATAAGTCACCGAAAGATTAAAGGAAAGTTACTACGGGCCAGGCTCGATGGTCGTCTCGAAATGATGCATAGCGACGAATTTTTTCTT
GCAGACTTGTTGGATCCCAGACACATGGGTCAGAGGTTCTCGTCGAACCAGTATACGCGTGCTAAGGACTTTCTTAAAAAGCTTTTAAATGGAAACGAGG
CTTTTTACGACAAGGTCACCAATCAGTTAAATTGTTTTCAGAGCCGAAGTGAAGAATTTTCCGTTCCTGAGATATGGCGTCATATCGATAAGCCTTCTCC
AGATGTGGAAGTTTCTGCATCTGATTGGTGGCTTTTGCTGCCAAGATTCATCTCGATTAAACATTCCGAGCTGAGACAGGTAATGAAAGTTTGTTTATTT
TATTGCTTGATATAACTTAGTCCTATTTTTAATGTAGATTGCCATGAAGTTCTTGTCCATACTATCGTCAGCCGCCTCTGATGAACGATGTTGGAGCAAC
TTGGGCTTCTTACACTCTAAGAGAAGAAATCGCTTACTTGGATCGAGAGAAATTATATTGGGCTATGTTTACATGAACACGCAAAGCATCAAGTGCATAC
AAAGATCCAGTAGGGATAAACTCGGCTATCGCTACGACCGCAAAAGGAGAAGAGTAGGGTCGTCGTATCATCTGCAGAGGTTCGTATCAGAGCCAGTGGT
GGAGATAGAAATCAGACCGTGGTCGAAGCTCAAGATCTCGTGGAAATTGACGGGGGACAAGACTAGGAACATTCAGCGATGTCAATTACGGAATATGAAG
GGAAATTAGAAGACGACGGCGATGTCGACTTCGGTACTCAGACTGCTGCTTCTATCGTAGCCGACGTGGTCGCAGAAATAAGCTTGCATGCTGATATTGC
TTCTCTAGACGAGGATAGCGATTGTGATGATAAAAGCAGCAAGAGTAGTGAAGATAGCACACAGCAATAGCTAGCGTTCCACATGCATAACCATTAAGAA
AGTATACTTGTCTACCAGATAGCAACGCTTCAAATATTTTTGCTGATAAACGTTAGTTACGATCATTGTTGCCACGATACAATGCAGAAGATAGCCGTTA
CCGTTATTGTCTGCTATTGAAGATGCTTAATGGTAGCATGTTTTTGTAGCCAGCTTGCTATAAAACCTGGTAAATATATGTATACGTATATATATCGAAG
TAGAAGCCTGACAAACGATGACATTGAAGAATGATGGGGGCAAACATCTATAATGATTTAAGGAAGTCTTGCAAGATAAAAGAAGGGTGAGGAACAAGAA
CATAGGGAAAAGGAGGTAGTAAATCGAATTCATTAATTAAAGAAAGCTGTGTTGTCATACATCAGCCACTATCAGTACGAAAGAGCTTGTTGCGATGCGT
CATAACTTGGGCCTTGGAATGCGTTAATTATATCACAGTGGACACATCGTTCGATTAGCGTCCAACACCATGAACTCGTTACTTATCATTTCTGTATACC
CCAACAGTACTTTCTCTCTCCTGAGCTTGATACATATTCTTCTCAGTTTAATCTGCTCATGGGACATTCATGTGCACAGCCACTGGATACTCACGAGCAC
CTACACAAGATAATAGAGCCACAAGCGACTCATTTAGTACATCGCAACTCTCCTCGCCGTATACACATCACCTCCTTGAGTGACCATAAGTGACCACGGC
ATATTCCAATCACATTTCCCTTAAAGGACGGGGCTAAATACATTTTAAAAATATCGTTATGGTCAACAAAAGATTTTGGACGCTATAGGCCTGGCTACTG
CATCTCCGACAGCGTCTTTGAGAACTGCAGACGTTTGGACAATGGGTGCAACAATGTAGGATGGAGCTTGATAGAAGTATAACCCCTTTTATGATGTGTT
GTGCCTATTAGTCTTCATTCTATAAGAC