Description :
From Genome Similarity Track
Location :
scaffold_84:16336- 20729
Transcript NameFunction/comments
Pl_110151DNA polymerase zeta catalytic subunit, putative

Sequence
4393 bases(100 bases per row)
CATGCTGGCGAGCTTTCACAGATGACCGAGGCAATGTCGCGTACCATGATCGGATATTGGCCCCCATCAGCAAGAAAAGACGCTCGAGGCTCGGGATGAT
CTTCAGCACGGAATATTAGTTACGAATACACCTCCAGGGATCTGCATTCGTACCTGCTTGTTGATGTAGTAGTGGTAATTAATACTGTAGCGCTTCTTCT
TATCGAAGTACTCATCAGGTGACACAACCAAATCCATCAGACGCGCACCTGGAGGTCCGTTTATCACAACATACGGTACTCGCTCGGCATACCGAGGTTC
TGCTCTTGGATCCTTTCCCATAGCTTTTGTACTTACGAGTGCTGCAGGAGGAGCGCTAACAAAACGTGTTAACATCAACAGTTAATGACAAAACAATGAT
CGCATATAACGCAGTCTCATACCTTCCATTGCTGTATGTTCCCAAACGAACCTCTTTTGCAAAAATGAACTCTTTCAATGCCACGCGATTCTCCAGAATT
TGAATCCAATATTTCTCCATCCCTTCCTTCACCTTAGATAAATCGCTGGACGCGAAAAGTTTCTCGAGAGACGCTTGCATTGCGTTTTGAACTACACCAC
ATGAATCGCGTCGAACTGTTTCAAGTCCTTTCGATTCAATGACTCCAATTTCTTGGCCCGGAGACTCGAATTTGTTGCCTACGTACCGCTTCTTCGACAC
AAGAACACATCCCATGTAAACCTTCTCCAGCTTCAATGTCACCGGTCTGAAGTGTAATTAGTAACTTAGCAAACCCATACCCAATCATGCGGCTTGAACA
ATAAGTGTTACCTTGGATTCGATGCGGTGACAGCACCAGCGATCTCCTGACCTATTCGAAATGCATCTGCTTTCGATCTCCCCTTAAGCAAAACGAATAC
GCTATCTGTATCGCCATAAACAACCCTGGCATTCCAGTCTGACCGTCCTTCTATCAGCCGAACAGCAGCTTCAAGTGTACATCTTCCGGTCTATCCATAA
AAATGAGTAATGCTGACAATATGGATATTGGGATACGATCGGTGTAGTGATCTTACCTGAACAATAGCATCGGCCAACTGAGCGCACGGCATACGTCCTG
AAAACCCAGCCGCTGTGTATCCGTAAGTCACATTCGAGATCATTTTCAGTGCTAGCTGGCGTGCATTCAACACTTTCTCGAGGCGCTCCTGGCCGGACTC
TTTCGCCGTCTTCATTGACTTTTTAACCATAATCCGCGTTGACAAAATTTCGTCAAGAATAAGTGGGAGAACTCCATGTCGATAACTCTTGGGACAGAAC
AACGTGCCGTTCGGTGCAATGATTATGTCGTTTTTGCACTGCAGAAGTCCCGAGGTGCTTGGAGCGAAATTAACAACTCCCAGAGCAGTCTCCAACTCGG
GATTTAAGCCATCTTTCAAACGACCCAAAAAGCTCGAATAGCACAAATTGTACCCGATCACAAGTGATGGATAAAGAGACTATCCAAAGCGAAATACAAC
ATTAGCAGACTTCACGTTACCACGCAAACATGAACAAAACGCACCTGAAAATCAAGCACCACGACGGGATCAGAATAAAAACTCGAATGCGGTTCCATCA
CTAGTGGAATGCACTCCATCGGAGCCTGACCAGCCACTTGCGTTCTGCTTGGTGACACCAATAGAAAATTATTACGCTTAGTCACGCGCAGCATGACAGC
CTCGACTCGATACTGTGATCCCCGAGATAAAACGGAGTAAAAGTCGATGCCAAATAGTCGCGCCATCTCGCTTCGTGTTCATTAACCCACAAAACAGTTA
GTTCAGAACATGACTGCTAAATCACATGCAGAATGCAAACGAATACCTCGTTCTTGTGATCAGCTGCATTATTGATATGATTTGGAGATTGAGTACAGCT
CGTTCCAAATAGTATCGGATCACTTTCCAACGCATTTCACCACCTTCTCGAAACCATGATGTCATTCGTTCAGCAGAGTACACGGGGTACGTTCGCTTTA
AAACTGTCCATACAACATCTTCAAGAGCATAACGCGACAATTTGAGCTAAAGGAAATACACAAGTTAGAGTGTAAGGAAATTGACACCTGGTAACTGCAC
TGAATAGCACACGATACCTCAGACCTTGTCATCCGCCAGAGATTCAAAATATATCTGCCGTGAAGCCATAAACCTGCCGACTTGTTCACTCCCCACGTCG
TGCCGATAGGCGCTTCCTTTTGGCTCCCACCCTCATTGTCCGGAACTGTAGTCAAATTTCGAGGGTCTATTGGTGTCGACGGAAGGCGAGAAAGCGACTG
GATGAGGTTTATCTACACATTATCATATGAGAATTGTGCTCACAACAACAAACAGCAGACACTTACATCCAACTGCGATGCTCGATCGACAAGATAACCA
ACTGAAGCCTTTTGCACCTCAAATCCTGTCAAGAAGTCAGGGTCCCATCGCCTTATTAGCGCTTCCAGTGAACGGAAGAGTTCCCGCTCGTCTGAAACTA
CAGTTACTACAGCATTGCTGCTGTCCACACACAAGCCCAGGCTTCCAAGGGTTGATTGATCCATATCACTCGGTTGTGAGATAAGAAAACCGCGTTCTTT
TGTTTTGGAATCCGTCGGTCCCTCTTGAGCATCTACTGCGTAGCATATCACGCTGACTGAATCGTGAAGAGGATCCGGCAGTATATTGCCTCGGGATGAG
GCAAATATCTCGATAGCTAGAATCGTTATGTTCGATAGTATAGTCGACGAGCCCAATTTAATCGAAGGTGATGCCGTAGAAGTAAGCGATGGCAGAGTGC
GCTTGCGTCGTACCTGGACAAGAATTTCACAAAATCATCAGTGACAAACTCATCATAACATCGTTCCATCTCGCACCTTAGCTGGGATTTGGCTCTTTTC
AGATTCACTAGACATCCAAGCCTCGACAGTAGTAGCATCTGGGGGTAACCGTGCTGGCATTCGTAAGCGACGCACCTGTCAAGTCAAACTTGTGAGACTC
CGATCGTACGAACGGCAATTTCTTGCACTTACCTTGTCACCCCGTCCGCGACGGATATCAAATGTATTTAACTGTGAGAGTTTACACCAGAGTGGGTTGG
TCGTGTTGTCACTGCTTCCAGCACTGTAGAGTGGATTTAGAAGTTGGCGCGTCGCGGTGGTATCAAACACCGGCAGATTACTCGTATTTTGCGGCGTAAA
ATCGAATTTCTTCCCACCGAAAATCATGGCTTTGTCAGGGATATCGGCTGAATTGCTGTAAAAAGCGGGTTGATACTGAACCACATTCATCCAGACTCCC
AGTTAGCTACTACTGCGTTAGCACGATTGAAAACTCAAATATTGTTTAGTCGAACCTGCACTGGGTTCACGCCAATGTTGTGTGACGATGAAAGGATGTG
AGAGAAAGTAGGAGGCTCGGGATTAAACAGCCACAAGCGGTTGTTGCTTGTTGCTGGCGCTGCTTGAATCCTTGGACGTGCTTGGAACGGGTGCGGATGC
GGTGTTAACGATAATTGAAGGCGATCTACAGGATCCGATTCTTCGTCCGGTGGGGTTAGAGGTATCGGTTCTTGCGGTCGAGGTGGCAGTAAATCTTCAA
TATCGCCTACCAAGGGCAAATCCTCTGGACTGGCGCCAAATCGGATAGCCCTCGCAGCATTCGTAGACGACTTCACACCGTTTCAGTTAGTATGCAAACT
GTGTCGCACGTTATCAGAGAGAGATTCAAACCTTATGCGATCGCTTGTGTGGAGTACAGAGGATGACGCGTGGACTACCCAGCTCACTGAGTGGACTTGC
GGTTGGCCGAGATTCGCGCTCAGCAATATCCCGCCATCCACTGCCGCGTGGTGAGTTAACTGCCTGGCTCGCGATGTGCGCTTCAACGAAGCGCTGTGAA
GCCAAGATATCACCAATTTCGTCATTTTGATTGTCCCACTTGTTAATTTCTTGCTCACGTTCATCGAAGTCATCGGCTTTGTTGTACTCGTCCAGCCCAT
CATTTTTGTTCCAGTCACCGTCTGCCTGATCTGGCTCACTTTTTTGTTGCATTTCCAAGAGTATATTTACGATTGCTTCGTCCTCTTCATTTGACATCTA
TTCAAAAAAGTCCAAAGTTAATAATTAGTGCAATTCAGCTATACGCCTTGAATAGGGTTACCTGGTTCAACGGATGTTCGATGCTATCATCCTCAGCTTG
GCTGTAGGAAAATTCGCTCTCGACGGCAAACGAATTTCCACGCGGCGTCATATCACTTGCGGAAATTGACTTATAACGGTCAGGAGAGCCGCTCTTGGTA
TGACATTTTTCCATTTGTTTCTCCAATTTCTCCATAACCGTGTCAACAGAATCTTGCATTTTCTTTCTGAAAAACGACTGTGACAGCAACGAT