Description :
From Genome Similarity Track
Location :
Scaffold_75:16336- 17624
Transcript NameFunction/comments
Phyci_30094Hypothetical protein

Sequence
1288 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGACCTATGTAAACACCAA
CACGACACTGTTCCCAGCCAACTCGGTGACCCTAACCTACGGATTCGACTTCGTTAACACCACGGACATGACGAACTACCCTATGGGAAACTATGAAGTT
CCCTTCAATGTGAAGGAGCACGTCGGGTACCCGGCGAAACTCGCGGTGAAGTCCACAGCGGGAAACCTGGTACTGTGATTGGACGTGTTgcattttgcaa
aacctaacaagctcttggcggagttctgggtggtaattgtgtggtcttgaacttgacgatggaatcaagtatcgattcggactgctttcgtggcagtcac
cgtgatgttactgaagatgacgctagcacaaatcaagtggcgaggactagtacaaccgaactagcgcagtcgttcaggctggatgaagacctggctagtg
atcgcgctagcagcgggagtgtgaagcgtcatacttgcatgtaagctaagctgagtggtgaggaggactagcaaggctaactcaaatttactttccaatt
tactaccaactacgcagatctacctcgaaggcttctcatcggcggcaaattcctcgcgggatttctcaaagtgcaacaggttctgagcccaaaccgtggt
tcgccgattagaagacccttctcgaaatgtcgatcactgggcgtctcgacttttcagacttggatagtccgcaggcgatgccgcatgccgcgacggcaga
gcgagcgcGCCGGCGTCAACTCGTCCGAGTTCATCATGAGCTGCATGATCAACTGCGGAcaccacccggctcacctcacgacagggataccgactcgtat
cggggcatgataacgcccgagcaagcatcacgggcgacgccgtcgtcgcgtttctcccccttgttggatgaggctatggttgacatgttgacagcccgcc
tggaggacggcatggtgataatcagcacgcagcggcgaatgctgaaagagcggcacagagcagaagagctgcgcacttcaacgaagga