Description :
From Genome Similarity Track
Location :
Scaffold_62:163356- 164518
Transcript NameFunction/comments
Sapdi_VS20SDRG_13674hypothetical protein
Sapdi_VS20SDRG_13675hypothetical protein

Sequence
1162 bases(100 bases per row)
GCGTTGGCAGCTCACGCGGATATCTTAGGTCTACGCGGTCACCGAGTCGTACCACCACGTCGCCCAGCAAGTCGACGTTGGCGACGACGGCGTCAACGAC
AAAGCCGGTATAATGCGTCTTGACTCTTGTCGATCCCTCGCTTATGCGGCTTGTGTAGAGCTCTATATGCTTATGTTTCTACGACAACCGCAAGTCCAGA
CACTGCTAGGATAGGACAAAACACTGATTCGCAGTATGTATCGCTGCTACCCCGTCATCGAAGGCGCGGGTCGGCCGTCGTGTACGTGAGCCTCGGAAAG
TACACGGTATAGGTCGTACTCAGTGGGGGTGGATCCCGCCGAGCGGCGTCCGCTGGCGGCTGGTCGGGCGGCGAAAGTGGTGGCTCGAACCGGGGTGGCG
TTAGCACGACCGACGAGGCCAGCGATTGGAGACGCTCTTGCACGAAGCGCGTCGACGAACTCCACCAGTCGCTAGCGTCGCCCGCCATCGAGGGCCAGCG
GCTTGACCGGTCCATGGTTGTCGAGGAATCGCAATCCGAATTTAGCTCGGTGGAATCGTCTATTTTGAGATTGAGGATGAACTCGGGCGACCTGAGCCTC
GAAGAGGTCGGGAACCTTGAGGACCAGGAGCTCCTCGCGCTCGCTCGCCTCGACGCGCAATGCACGGCGCTCCAGGAGGCAGGCAACTATACCCAGGCGC
TCGAGGTCATGGAGAAAGGGCTCGTCTTGCGGCAGCATTTCTTCGGCTCCGACAGCGACGAAGTCCGCGCCGCGTGCAAAACCGTGGGCGACCTCTGCAA
CCTCCTCGCCATGACGTTTCTCCAGCAAGAGAACTTCCCCATCGTATTCGAGCTCCTCAAGAAGGCCGAGATCCTCACGGAGACCAACCCCGCGGGCCGC
GCCGTCACGCTCAACAACCTCGCCTGCTACCACCGGCGGCTCGGCCACCTCCAGAAAGCACTGAGCCATCTCAACGAGGCGCTAGCAATCGAGGCGACGC
TCCTCGACGTGCCCAACCGCGCCGATACGCACCTCAACATGTGCGCCGTGCTCTCGCAGCTCGGCCGGCACCAAGGCGCGCTCGAGCAGGCGCAGTCGGC
GCTCATTCTGCTCCACGAAGAGCTCTTCTCGACCAACCAGATCAACCTCGACGAGAAGCTGG