Description :
From Genome Similarity Track
Location :
Scaffold_2526:1633- 4457
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2526-snap-gene-0.1Gene of unknown function
Pytar_ATCC12531maker-par_contig_2526-snap-gene-0.3Pol polyprotein, partial
Pytar_ATCC12531maker-par_contig_2526-snap-gene-0.2Gene of unknown function

Sequence
2824 bases(100 bases per row)
GACCCGCCTGCTCTGGCCAAGCCACTGCGGGTCACGTTGAAGGACGGCGCTGAGCCTGTGCGCTGCCGCGCTCGCAAGTATGTCCCAATGCAGAGTGCAT
TCTTGAAGAGCTACACGCGCCTACTCGAAGCCCATGGCTTGATCCAGCGCAACAACATGGCGAAGTGGGCGTGTCCAGCTGTGCCTGTTTGGAAGCCCGG
CACGAATGACTTTTGCAAGACGATCGACTATCGCCCGGTCAACATTTTGACTATCCCGATCGCTGATACTATGCCGAATCTCAATGTCGTCACGTCCCTG
GTCGAAGGCTCGGTGGGGTTCGCTAAGTTCTATTTGATGAAGGGCTTTTGGCAAATGCCCCTCCACCCCGACTCCCAGGAAGCGATGTCGTTCATGATTG
AAGACACAGTGTATACTCCTACGCGGGTCCCCTAAGGCTCTATGGACTCGGCGGTCCATTTCCAGAACCAGCTCCAAGTTGTGTTCCGCCCAATGTTGAA
CCGTAATGTTCTCATTTGGATTGACGATATCATCGTCTTCGCCCCAGATGTCCCGTCATTCCTCGAGGCGCTGCGCGAGTTCTTTCGTCTGCTCGAGCAA
CAATCTGAAGCTCAGTGTGTCCAAGAGCGTGTTGTTCATGGCTGAAGTTATCTGGTATGGCCGAGTGATCTCGGGGGAGGGCGTGCGACGCGACCCTGAA
CGTCTGTCGGCACTGTCCACACTACCGCCGCCGCCTACCATCGCCGCGCTACAGCAGTTCCTATATGCAGTGAACTGGATCCGCGATTCTCTCATCGACT
ACGCTCGCGTGTCTGCCCCACTCTATGAAGCTCGAGGTTGCCATGCATCAGGTCGGCAAGCGCAGCAAGAACGCCCTCCAAGCTGCTGTCACCTGGTCGG
AGTCTGAGGCTGATGCCTTTGGTGAGGTGTGCGCGCTTGTCAGCTGCTCATAGGAACTCTTTTTTCTGCCAATGCTGAGCTGTGCCTCTTTACTGATGCC
TCGGCGATTGGCTAGAGCATTATCGTGACTCAGGTGCCACTATGGGATGACCGCAAGCCAGTCCAGGACCAAGCTCATCAGTTGGTCATTTGTAAGGGCG
GACTCTTCAAGGGCAGCGAGAAGAACTGGTCGGTTGTCGAGAAGGAGGGCTTCCCTATCGTCAATGCCGCGGCCGACCTTGAGTATTTGCTGCTTCGAGA
TCGTGGGTTCCGACTTTTATTGCGACCACGCCAACCTCATTCACATATTTGACCCGGTGAAGGAGCTCAATGGCCATATCCATGACAAGTTACAGCATTG
GGCGATGCGACTCTGTGGGTTACCCTACGCATCGAGCACATTGACAGTGGGCACAACGTGTGGGCCGGCCTCGTCTCACGTTGGGGCCAAGCAGCGGGGC
CAGGCAGCGGAACCAGCATTTGCGCCGTATCCATACGCATGGCAGTTCCACCGTCGGCTCTTCNNNNNNNNNNCGCCAGGCAGCGTAACCGGCATTTGCG
CCGTATCTACACGCAGTGCAGTTCCACCGTCGGCTCTTCGTCCACTTGGTGACACGAATTTCCAGTGGCCGACAATTGCAGAAATCATCCAGGTACGGCA
ACAGTACGTTCACCTTTTGTCAGTCGCCCATGTCCTAGACGAGAGGNNNNNNNNNNCCAGTCCAAGAGCGCGAGTTGCTCAATCGCCTGTTTGTGATCGC
CCACTGTGGCTCCCATGGTCATCGTGGTAGAGCCTATGGGCATCGTAATCGCCGAAAGGTTCTGGGTGGAGAATCTGATCTCTCGAGTTGAACGATTTGT
CCACGGCTGTCTCCTATGCAAGCATGACAACGGCGGCCAGCTGATCCAGCGCCCATGGGGTCCGACCTACGTCGCAACCCAATGCAATGAAGGTGTCCAT
TGGGACTTTCTTAAGGTGGGCGACAGTTGGGGTGCGAACAAGCATGTGCTCGTTGTCAAGGACGCGCTGACTCACTACTGCGAGCTATTTCCGTGTGCGT
CAGCCGGCGCAGAAGCCGCCGCAAGTGGCCTGCTCGAGTGGTACAAACGATACGGTCGCCCTGATACGTTAGTGTCTGACCAAGGCAGCCACTNNNNNNN
NNNATCGTCTGAGGTGAAGGACGCACTGCGGTATGGGCGACCGCATCGATGAGCTCAAGGCTAGTCTCGCTNNNNNNNNNNAAACACGGTGCTCGAGATC
CTCTGTGCACGCTTGAAGATCCAGCAAGAATTTACCCCAGTGTACACTCTCCAGGGATCAACGGAACTGTGGAGAGGTTGAACCGCGATATCCTACAGGT
TATGCTCGTGTTGTTGCTCGAGTACAATTTGGATACGAAGGAGTGGCCACATCTTCTACCCGCCATTCAAGTCAATTTGAACCAGACTCCCGTCGGCTCG
CTCGCCGGTCACGCCCCAGTCGAGTTGTTTCTCGGTCTCCCGGCGCCAAGCGCACTTGATGCCGTCGTCTGCGGTGAAGGACGCACTGCGGTATAGGCGA
CCGCATCGGTGAGCTCAAGGCTAGTCTCGCTGGACTCCACCGCGAGGTCGTCGACGTCAAGGAAAAGCGCGGACTCCTAGCCATGGCAAAAAAGAATGGC
CAACCGGCCAACTTTGACGTTGGTGATTTCGTCCTTTGGTCGCGTGTGGACAAGCGTCTCTCCAACAACAAGCTACTTGCCCAGTGAATTGGGCCGTTCC
GAGTGTCCCGTGCGAGCGAACGCTCGTTCATCATCCGTCATCTCAATCCTGGTTCCGAGTACGAAGTCCATGGGTCCCGTCTCGAGTACTATGCGGACGC
CAGCCTGAACCAAACTGAGGAGAT