Description :
From Genome Similarity Track
Location :
Scaffold_2162:1633- 3663
Transcript NameFunction/comments
Phyag_g12136hypothetical protein PHYSODRAFT_484119

Sequence
2030 bases(100 bases per row)
TCGTCGCCATAATAGTGCTAACCAGTCCAATCTCTAGCACCGTTGGCACCACTCGAAAGGCTATCGCACGCAACACGAAGTCAATCGACCGTGAACCTCG
GTCGATGATACGCGACAGCGCTCCCGTCTGTCGGTCCAAATGAAATTTCAGATCCATCTCATGCAAGTGCTTAAACACACGCACGGCAACCTTGCGGATG
GTCTTCTGCGCCACCGTTGCGAACACCCCATTGGCTAGTTCGGACGACGCACTGGCGCTGAATCTCGCCAGTCCATAACCAAGCACCATGGCGAGCGGCA
CCGCGACCTCAGGCGACCCTGCGAGTACTGTAGAGGCCTCACCCATACtgtccaccagctccttaAAGATGAACGGCACTTGGATCGTCAGCGCCTTGGC
CGCCACCACGAGTCCCGCCGAAATGAGCACCTtctgcttgatctccttggcctccttggTGTCTTCGTTGGGCCACAAGTGTCCCATGAGGAAGCTCAGG
ATCTCCGTAGCCGTGTCGGGTGGACGGTCCAGCCCCATGCCGCTTAGTGCATTGAGCTGTTTGggcttctttttcttgtcaTGATCATCCAGcgcagacg
aagagaagctCAGTGCGCTGTTGCCCAGTGCGGGGAAAAGGAAGGACGCggtgcgacgacgaccaagcCACAAGGCGGATGGGGACGCAGACGCTCGGTG
CGCGGCATTGAGGCGCCGCACGCCGCGCaggaagatgctgcggcCATGGAGCAGCGACATGATGCGGAGTAAGCAGATCTGGAAGTGACTGCTGACGTTT
TGGCCGATGGCGATCGGAGGTTGCGCGAAGGTTGCACAAGAATGAAGGTCGATTGCGTTGCGATTATTAACACCCAGTCTGGCTCAATCGGACCACGCGC
TGGAAGTccaaaaaataaaaaaaaaagtcGCTAGGCTGAATTGGACGCTCAAATTTGCACACATGGGGTGTATGAGTCTTTTAATAATGTCTACGTGCTT
TGAGAGCCCTGGTGACTCTACAAGACAAATAAATGATCATTGTATAGCAGCATCTCGCTTCAATAGCTGCTCCTGTCTTGCTTGTGGTCATCGCTGTTGG
ACCTATCCCTATGCGTATAAAAACGCCTGTGGTTACATGTATATAACCCAGCGGCGTGGCCTCCGCAAGAAGTGCTCCGACTGCATACTGTCGAAGACTT
GCTGCACCCcgtacacgtccacagcCACGAAACGATTGGTGCCGTCGACTCCAAATTCTACAGACACGAAACTACTGGTTTGAGCGGGCGACGGTCTCTG
ATCTGTCTAAGTATTCCCCAGCGTTCTCTTTTGCGTGCGGTCCGACATAGGCATTTCGACTTGACCCAGGCTCCAGATCTGTGTTAGGAAACGCTCCATC
TTATCGTACGTAACGAGGGCCCCCGAGAATGCAAGACTGCCTGGACGAtaacaagatgctggacgatgTCATCTTGATTGAAGGCGGTCCGGACGAAGGC
CCCTCAGCTGAAGATGTTCTCGTTGAAAGTGTTCCAGATAAATCACTGTGTACAAGTCCACGTATGGGCCGGTgtgttcaagaagaaaactcTCTGGAAG
AGAGCGGCgttggagatggagttccGGACGAAGGGCTACCAGTTGAAGGCGTTCCAGACGAAGGCATCCAGGCTGACGACGCTCCAGATGATGACGTTAC
GAACGGGGTTGGCTGNAGAAAACGAAAAGCTAGCAAGTACAAACCGGGAACACTGTTTGAATCTCCAATCATTCCTAAGCGCAACAAAAGAATGCCAATA
GCACCGGACGGTAAGAAATTGCGCAGTGATTCATCAGCGACAGGTGCCGGTCCAAAGACGATCGGCGATATTCTGCGTGCAATTGGACTTCCCGATCGCG
TAGAACATGCGTATCACCATGTTCCCTCTCTCAAAGATCGCCAAAATCCAGATACATGGCACGAAAAGGGGAACCCTGCAATTACATTTACAGAATCACT
GATGGAGGAAATTATGCGTCGGATAAGCTT