Description :
From Genome Similarity Track
Location :
Scaffold_1229:1633- 2939
Sequence
1306 bases(100 bases per row)
AGGAGCTCCTGGCAATGCGGTACGCTCTGATCAAATTCAGAGTGTACCTGCTCGGTGAACAGTCATTTGCGGCTTACACTGATTACGCATCGCTGCGGAC
AGCGATGAAGAGCCCTCACTTGTCGCAACGGATGGCCCGTTGGCTGTCATTCTTCTCCGAGTACAACTTCGTTGTTCACTACAAGCCGGGCAAGAATAAC
ATTCTCGCCGACGCGCTGTCTCGGCGTCCGGACTACGATCCCCGTGAAGCGCTAGGACATCAGCTCGCTGATGAGGACGACGACGAATGTGCGGTCTGCG
TGTCGTCAGGCATCAACTTGATGTTGACAACGCCCACGCTCCCGCTGGGCGACGAGATTGCTACAGCGTACGATGATGACCCTATATACGGCGCCATCAT
GAAGCACCTGCGTGCTCCTAGTAGTGACACGCTAAGTGCCCTGTCAAAGACCACGCGGAATCAGATCGATCGATATCGACTGGACGGTAATCTGCTCAAG
TACAGCATCGACAGGTTCGATGGACCTCGAGTCGTCGTCCCAAACGACGCTGATCTACGTGCGCGCATAATCCACGAGTAACATGACGCCCCGACTGGAG
GACATCTCGGTCGCGAGAAGACGTACGCGGCTCTGTCGAGAGACTTCTATTGGCCGCACATGTACAAGTGGGTACGCAAGTGGGTCCGCACATGTGAAAC
TTGCCAGCGAGTCAAACCGTCTTCGACGTCTCAGGCCCCATTGCGCCCTCTTCCGGTCGCCACGGAAGCCTGGCGCTCCATTTTGATGGACTTCATCCTC
GGTCTTCCGCCCGATACAGCCGGGCGCACAGGTGTACTTGTGTTCGTCGATCGTTTCAGCAAGATGGTCCATCTCGTTCCGGTGGCGGCCTCAATCACCG
CGGAAGAGTCCGCGGCCCACTTCGTCGACGTGATTTTTCGTTACCACGGCCTGCCGGAGTCTATCGTGTCCGACCGTGACCCGCGGTTTACATCCGCGTT
CTGGTCCCGCCTCTTCGAGCTCTTGGGAACCAAATTGCTGATGTCAACTGCGGCACATCCGGAGACGGATGGACAAACAGAACGCGTCAACCGCGTCCTT
GAAGACGTTCTCCGCAGCTATGCAACTTCGTACACGAGCTGGAGCTCGTTCCTACCGCTAGCCGAGTTCGCACTCAACAACGCCGAGCACTCCTCGACGG
GTATGACGCCGTTCTTCGTGAACAACGCTCGCCACCCACGTGTTCCGGCACTTCTCGCCATGGGTCACCCCACGGATGCTGGCGGCCCACCCTTGGTGGG
GGAGAA