Description :
From Genome Similarity Track
Location :
Scaffold_501:16326- 17798
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_501-fgenesh-gene-0.2Conserved gene of unknown function

Sequence
1472 bases(100 bases per row)
TGCCGCGACCATGTCTGCGTTCCAGACAAGCTCTTCCCGCTGTCCAAAACCGaGATCTATGGCTCGATCGCAGCGTTCTTGTCCAACATCCTTGCGGCCG
GCTCAGGACTTGGTGGCGGaGGCCTtcTTGTGCCTCTCTACATTCTCAGCATGGGACTGTCGTCGCATGAAGCCATTCCTCTGTCGAAGGCTACGATCTT
CGGTAGCTCCATTGCCAGCTTTATCATCAATGtGCGCAAGCGCCATCCACTAGCTCGAGATCGGCCACTTATTGACTATgAGACCGTGCTGATGATGGAA
CCAATGACCCTGGCCGGAACCATCATTGGTGTCAACATGAACAaGGTCTTCCCCGAGTGGCTCATCACAGTGTGCATCGTGTGGCTTCTGACGAAGACGA
GCcTCCGCACGTACGCAAAGGGCCTCAAGATTTGGCAGGAAGAGAGTGCAGctGACACCAAGATCCTCGCCGACATTGTTGCCTACTGGAAACTGCTGCC
CAGCgAAAGCAAGTTCAAGCAGTTCaGCGCTGTGTCCCGGGCCTGGCTCAAATGGAAGTCCTACAAGCGTCCACTGAAGGAAAACTCGCTGAAATTGGCG
ATCTCGAACCCACAGGAGGACGATCGTGCGTCGCTAGCTAGCACCGTGCTTTCCATTCAGGACTTGGAAGAAGACATTGACCTCAGTGACAATGCCAGTG
AGGATGAGACCCTGATGAATGCCGGCGTTAGCAAGCGAGATCTGATCACGGATCATATGCCGTCGCTCGAGGAGCTgAAGAGCTATCGCCGTAGTGTACC
CTACGGTGATATCTTCGTTCTTTTCCTAACATGGGTTGGCCTAGTGCTTTTctCCCTTGCCAAGGGTGGCCACGGCAGCCCAAGCATTATtGGCTTGTCG
TGCGGCAGCCTCGGCTATTGGATGCTCGTTGCCGTCTCGTTCCCGTTCTTCGTGCTCGTCACCTTgTACTACGGTGTGAAGATCGCCCGCGTGCATCGCT
TTCTtCGAGCATCCGGGTACGAGTACGTCAAAGGTGATATGGTGTGGGACAAGGAAGCAATCGTCAAGTACCCAGCTTTGTGCACGGCTGCTGGTCTGGC
TGCTGGCCTGCTCGGCATTGGCGGTGGCATGGTGAAGGGTCCACTGTTGCTCGAGATGGGCCTCTTGCCACAAGTGTCCTCGGCGACGTCGTCGTCGATG
ATTCTGTTCACGTCGTCTGCCACGACCATTCAGTTCATCATCCTGGGCACGCTACCAGTTGAGCATGCTCTGTGGCATGGCTTTATCGGCTTCGTGGCTG
GCGTCATCGGCCAGTTTGGTCTCTCGTACCTCATCAAAAAGTACCGTAAGACAGCTTTCGTGATCTTCTTGATTGCGGGTGTCGTGGGCTTCAGTGGCGC
TATCATGGGCGTGCTCGGCGCCCAAAaGATTGCCGTCACGGGCTTCGGTGGCTTTCGATCGCTGTGCCACAG