Description :
From Genome Similarity Track
Location :
Scaffold_410:16325- 21361
Transcript NameFunction/comments
Phypl_g8002hypothetical protein PHYSODRAFT_513613
Phypl_g8003conserved hypothetical protein
Phypl_g8004conserved hypothetical protein
Phypl_g8005ABC transporters ABCA family

Sequence
5036 bases(100 bases per row)
TCGACTTGTCGGATGGTGACTAGACCAGAAGCCTCCACCTCTGTTCAGCAAACAAGCAAACGACAAGCGTGTGAGTGTTTCGCCTTCTTTGTGGCACCTA
CGAGCACCTGAAGGGCGGCAGGGATCGACGACTAACCTTTGTGTAGCGAGAGTTTATCCATCCGCTGGCTCAGTCTCAAGCGTTCCTGCGCACGGACACC
CTCGCCAAGAGCCCCCGACGTCGTTTGGTACATGAACTCGGTCAACGCGTTCGTCGTCCCGATCTGGTtgttgctcgtgctggtgcgaAGGTGGGGGGCG
TCGAACACCACCTTTTCATGTAGATCGATGCCCACAACCCCAGAGCTCGTGGTCATGAACGGGTTGTTGGTGCGGCGCGTGTGGTGGATGGAAGAGCCTC
GCGATACCATTCTCTCTCACTCGGCCCTTGCactgcacaagctgctcgtgctaTTCACGTGTGCTGAACTTGTTCCGATCTCAAAAACCCgtcaccgcct
tcttcgcccCCGACAGAAATATCCATGCTGGTCAACTCTGCCATTTGCATGAGCGGCACCATTTCCGGCACACGTTCTTATCGGAAAAGATTCCAATGAT
AGAGAGACAACTTCGACAATGATGTAGCCATTCCCACTGGGGCTCATAGGAATGATTGGTCAAAAACTTCCGCATGAGCACGAGTATGCTGGTCGTGggg
atgctggagctgtggcAGCTCACGTGGTTGACCGCCGTGGCGGGCGGGTTGCTCTCGTTTCGGAGTCGTTTCTGCCGAgggctcgtgctgcagggcaaGA
TGCGCACCCCGGCTGCCATTTCGCAACTCCCCGGACTGTCGGTGCTGCGTGTGGAGGTGCCCAAGAGCTACTGGACGTGGTTCTACCTCATCGGGGCTCT
GCACAGCGTCGTGATGCTGGTTGCTGCATTGTTTTGGCAAGATACACAAGCAGTGCAATACGCACTGCACTTTGCCCACCCCTCGGCCGACCGAGAACAC
GTCACTATCCAGCCACACACTATCGCGTTTCTGGTGCTGTTTTCCGTACACACGACGCGGCGCTTCCTCGAGTCGCTCCTTGTCACGGAGTTTGGAGATG
CCAGGATGCATGCTTGCAGTACGTATGGGGTGCATCATCGTTCCTGTCTGCGCCACCGACGGTTAATCTTGTGTTGATGGTAGTTTTGTTCGTAGGCACC
TATCACTACGTTGCGACGGTGCTCTCGGTGCTCTTTGACCCGGACGCCATTTCTGTACACGAGACCACGACGTCTCGTTGGGTGATGACTGCGTTGGGCG
TGATGATATTCAGCATTGCGTCCTACCATCAAACACGCTGCAACTATCTTCTAGCAAAGCAAAAGCGTGCCAACAACATGAAGCACGTGCTTCCTCGAGG
AGACTGGTTCGAGGCTGTGCGTAGTCCGCTCTACACGACCGAGATCATGCTTTACGCGGGATTCATCCTGGTCACTGGGGGCACTACCAGAATGCTCTAC
CTCGTGTCCGCCTGGGTAGTCGTCaaccagcttctgctcgctcAGATCAGCTCGCAGTGGGTCGAGGACAAGTTCCGCGATCGAATCAGCGAGCTCCCCA
AGTGGAAACTGCTGCCGTACGTCTGGTGAGCGGAATGTGCAGGTCTGCAACCGTGTGAAGGAGTAAACCAAGTTGTTCACACTGCAAGTATGATTGAAAT
CTATGTGGAAAGCCCAACGTTCCAGTGTGTTCATGCTCATCAGGTAGCAAAGTGCTCGGCCATTGTCCCTTCACTTGGCCGCCTTCTGTTTCTTCTGCGA
GGATGCTTCGGACTCCTTGGTCTCTTCGTCACTGCCACTGTCGCTCTCTCCACTCGAGTCACTTCCATTCCCACTACCGCTCTCCTTGGCCGGTTGGtct
ctcttcctcttcctctctTCGCCGCCActctcgtcctcttcttcctcctgctcggTAGCCCACACCTGCTTGGTGGTCTCCCCCTTCCCGGCCGCTTCCT
CTCTGGCGACCTGGATCCTGGCCAAGTGCTGGCCGTACTTGTTACCGAAGATGTTGTGGTACCCTCCCGGTCCAGAAGCGCAGCCCCTGCAGCCGCTGTG
CTTCTCCTGCACCGCCTGCCCctccgagagctgctgccgtggcACGCGGCAGATGCTGACCGTCCCGTAGTTGTAGTTCTTGCTGTTGATGGCGAACGTG
CTGCAGAGCCGCTCGTAGCCCGGTTTCTTCCACTTGGCGATGAGGTTGGCGTCCGCCAGCTTGCGCCGCACGCAGTAGTCGTACACGTCGCGCGAGATCT
TGTGGTACTTGTGGAACATGTCGTACACGTAGCGGCTGCGCTGCCAGTTGATCTGGTGCACGGGCCACAGCGCCTCGCACTGCCGCTTGCCCTCGTGCGG
CTCATTcatcttctcgcgcagctcgctctccagcgcgtccatcACCGGCTGGATGTACTCGTAGCCCGCGGGCGCGCGGTTCTTCTTGCTCCACTTGGAC
ATCGCAATAGGTGGCTATTGCTTGATCCAATGGGCCGTGACAGGTTCGAGAAAAAACAAAATGATACGACTAGTTTGCAAATTACGCTATAAATCCATAC
AATGGAGAAGCAGTAATTACGGATATAGCCGTATATGGCTGAAAATCCATTTGACACAAAAAGGAGACAATTCAAAATACTTTTGTTATTATTAGCGTTT
GTCTCTTTAGTTGATATTCATACCGTGCGCGACgcccttctcctcctcctgctgggCTGCCATGTTGTTGAAAATGTGTTCCAGCGCGGTTTCGCTCACG
CTGTACTCGTCCACGTGCAAGTCCGCGCGCGTTTGCTCGAGTGCGCGGAAAATCTGAGCCGGACGCAACGCTGCGGAGCTGCCGGGTCGGTGCTTGGGGA
CTTGGAAGCGGAAGTGGTCGCCTTGCTGCTCCGCGAGGACGCTGCCTGGGAACTTGTCCTggacgaactgctgcagccgctcaCTGTGCGTCTCCGAGAC
CCACCACGAGCAGAAAGTGTCGACGGAGATCGAGCCTTGAGTCTCCAGTTGACTGCTGAGCAGCCAGCCCGTACCCGAATGGTCGAGGATTCGAGTACCG
CGTTCATGGGCCCCCAGGGCAGTGCAAAGGGCTTGGATGTTGACGGACATGACCTTCGCCCCACTGCTCACTTGGAGGCTGCTTGAGCTCTGTCGCTGAC
TCGTAGCCGAAAGACTCCGTTCCGCTGAAAGGAATGCCCGAACCTGGTCCACCACACTTTGAAGCTCGGAGGCGTTGGCGCCTGATGAACTCGTCAAGGC
GCGCAGCGTGATTTCTACCGTGTAGCCTCGGCCGAACTTCTGCTTGAGGTGCTCCACGCTGCCGAGGCATTTCAGCCGCCCACCTACGAGAATGCCCACT
CGAGAGCAAAGCGCCTCACACTCCTCCATACTATGTGTGGTGAGGACCACACAAGCTCCTCCGTCGCGACTACCATCGCGATCCGGCAAACACACGCGCG
CAATGACGTCCCACATATTTTGCCGGGAGCTCGGGTCTACACCCGTCGAAGGCTCGTCGAGGAATACAACGAGGGCGTCCGAGCAGTGCGATGGCTGTCG
AGACCTTGCGCTTGTTACCTCCGCTGAGACCCTGTGTGAGCTTCTCGCGGTATTTCGTGAGGCCTAGCTCTTGAATCTGCTCGTCAACTGCGGCAGCCAC
GAAGGCTTCCGGGATGCCCTTAATCCGAGCGTACAACTGCAGTTGCTCCTTCACGGTTAGCAGATCATGGAGGGCATCAAACTGCGGACAGTAGCCCATC
GTCTTGCACGCGGAAGCCGAACTGGTTGACAGATCGAAGCCGCTCAGTGTAACGAAGCCCTGAGTGGGGGCCAACTGACCCGTCAGCACAGCCATTGTCG
TCGACTTCCCGGCACCGTTGATGCCCAGGTAGCCAAAGCATTCGCCGCTTTGAATGGATAAGCACAAGTCCTTGAGAGCAACCTTCGCCCGTGGTTTTCC
CGCATATTGCTGTCGCAAGTTCCTCATGAAGACAAGATCGTTTGGTCGAGGGGCACGCGCTGTCGCTCACGCTgtacgtcgtcgtcctcctcttcttccg
tCGCCGTGTCACCCGCATCCATCGCCACGGCACTATGCTCCGCTTTCCCTGCTGCCGACTGCTTCCACTTAACCGATCGATTCTCGAGTACGAACACAAG
CGCGGTCAGAACGACAGCCTCAACCAACGTGTACATCAGCGGCGCACCAACAACCTCCAAATCAAATGGCTGCCGCACGCAGCATGAGGGTCCAATGCGG
CCCCAGCACTCCATGCAGTCTTCTTTTCCCAAGCCTTCGAACAGTCCGAAGAAGGATGGGGTCGCCGGAAGCCACCGAGCAGAGCCGAAAAGCGCGCGAC
GACTCACTTTGCGCGTGGCGAGCTCGAAGATGCCGTTGTTGAGCGTGTAGCCCGGGAAGACCATGAAGATCCACCGCAAGTAGTTCCGGTCCAGTGACGA
CAGTGTCAAAGAGCCCGAGATGCGGAAGTTGACGATACGACACATGAACGAGAAAATGCTCAGCAACCCGCCGGTGCCCAACGCAAACACGAGCAACGCC
GTCTGCGCCACCGCGTGCTTGACGTAGCGTCTTGAAAATAGGTACGCGAGTGGAATGATTGCCCAGACGTGCGCGATCACTAGGGCGATGATAGCGAACA
CATCCGCTGTGCTCGCATTGTCTGCACCGCTCGGCGTCATCGACAACGGGATGGTAATCGCAGAGGCAAGAATGGGGATAATCGTgaggagaagatcgtg
cGTCCAGCTTGCCATCCAGTACGCCGACACATTGGCGCCACTGATGAGCTGCAGGCTCTTGGCGTTCTGGATTGGGTCCTTCTCGCGGACAACGAAAGCA
ACAATAGCGGCCGGGATGAAAGCGAATGCCAGCATGGCAACCAGCGCGACCAAGAAGCCGTTGAGCGTCACTTGGAGCTTGGCGTTGTTCTTCGCGAGGC
AATTGTTGCTGTAGCACGGCGCTGATCCGCACGTGT